Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 473 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
 ~ Next article
 ~ Previous article 
 ~ Table of Contents
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (106 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~  Materials and Me...
 ~  Results
 ~  Discussion
 ~  Acknowledgement
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed8490    
    Printed218    
    Emailed3    
    PDF Downloaded687    
    Comments [Add]    
    Cited by others 19    

Recommend this journal

 


 
ORIGINAL ARTICLE
Year : 2007  |  Volume : 25  |  Issue : 2  |  Page : 133-136
 

Molecular characterisation of Cryptosporidium : An emerging parasite


1 Departments of Microbiology, Gandhi Medical College, Secunderabad - 500 020, India
2 Department of Biotechnology, College of Veterinary Sciences, Hyderabad - 500 030, India
3 Department of Microbiology, Shadan Institute of Medical Sciences, Hyderabad - 500 008 Andhra Pradesh, India
4 Departments of Paediatrics, Gandhi Medical College, Secunderabad - 500 020, India

Correspondence Address:
K Nagamani
Departments of Microbiology, Gandhi Medical College, Secunderabad - 500 020
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.32719

Rights and Permissions

 ~ Abstract 

Purpose: The aim of the present study was to determine the prevalence of Crytposporidium in local population and to understand its epidemiology by molecular methods. Methods: Faecal samples from 681 children and 804 adults, admitted to tertiary care hospitals in twin cities of Hyderabad and Secunderabad with complaints of diarrhoea; and six calves with diarrhoea, were screened for Cryptosporidium oocysts by microscopy and enzyme linked immunosorbent assay (ELISA). Polymerase chain reaction restriction fragment length polymorphism (PCR RFLP) based identification of Cryptosporidium species in positive specimens was done to elucidate epidemiology of Cryptosporidium. Results : Cryptosporidium was found in 52 (7.6%) children and 7(0.9%) adults and 1(16.6%) calf with diarrhoea. The prevalence of Cryptosporidium in children below five years of age was 8.2% and 14.3% in children in the age group of six months to one year. Of the 42 samples genotyped 29 (69%) were C. hominis and 8 (19%) were C. parvum and 5 (11.9%) were mixed infection with the two species. Conclusions : Children in the age group of six months to one year were found to be the most vulnerable. The occurrence of C. parvum , in nearly one third of cases in the present series indicates that the zoonotic transmission is of considerable significance in the epidemiology of Cryptosporidiosis in the study area.


Keywords: Cryptosporidium, diarrhoea, polymerase chain reaction, restriction fragment length polymorphism


How to cite this article:
Nagamani K, Pavuluri P R, Gyaneshwari M, Prasanthi K, Rao M I, Saxena N K. Molecular characterisation of Cryptosporidium : An emerging parasite. Indian J Med Microbiol 2007;25:133-6

How to cite this URL:
Nagamani K, Pavuluri P R, Gyaneshwari M, Prasanthi K, Rao M I, Saxena N K. Molecular characterisation of Cryptosporidium : An emerging parasite. Indian J Med Microbiol [serial online] 2007 [cited 2021 Mar 5];25:133-6. Available from: https://www.ijmm.org/text.asp?2007/25/2/133/32719


Cryptosporidium is an intracellular, extracytoplasmic coccidian parasite with a monoxenous life cycle. It invades the microvillous border of gastrointestinal and respiratory epithelium of a wide range of vertebrate animals and is associated with watery diarrhoea in mammals, diarrhoea and respiratory illness in birds and gastroenteritis in reptiles and fish. Towards the end of twentieth century Cryptosporidium emerged as an important etiologic agent of epidemic and endemic diarrhoeal disease worldwide affecting mostly children and immunocompromised individuals. [1],[2],[3],[4]

Recognition of existence of genetic diversity in Cryptosporidium led to the development of molecular techniques for identification of morphologically indistinguishable species. This helped researchers to understand the epidemiology and public health significance of Cryptosporidium spp. found in animals and environment. [2],[5],[6] Of the 13 species named, six have been reported to be responsible for human infection. C. hominis is the most common species reported from developing countries suggestive of anthroponotic transmission. [7] In contrast in United Kingdom and Kuwait C. parvum was found to be the most prevalent species indicating the role of zoonotic transmission. [8],[9] Besides C. muris, C. felis, C. meleagridis, C. canis have been infrequently reported in children and immunocompromised persons. [10],[11],[12]

In India, several studies have documented the prevalence of Cryptosporidium in paediatric diarrhoea (1.3 to 13.1%) from different parts of the country based on microscopic detection of oocysts in faecal specimens. [13],[14],[15] However, there are no published reports on species identification of the parasite in paediatric or animal isolates which can be useful in understanding the epidemiology of cryptosporidiosis.

The present study was undertaken to determine the prevalence of Cryptosporidium in and around Hyderabad and Secunderabad and also to understand its epidemiology by using molecular methods.


 ~ Materials and Methods Top


The institutional ethical committee approved the study. Faecal samples were collected from 681 children and 804 adults admitted in the tertiary care hospitals in twin cities of Secunderabad and Hyderabad between 2003 and 2006. The inclusion criteria included complaints of diarrhoea and other gastrointestinal symptoms. Relevant demographic, clinical and epidemiological data was recorded regarding the duration of symptoms, age, gender, socioeconomic status, source of water and exposure to animals. In addition, faecal samples were collected from six calves with diarrhoea from a nearby farm.

Conventional screening of all the faecal specimens by microscopy after concentration by formalin ethyl acetate sedimentation method was carried out for detection of various ova and cysts. Modified Ziehl-Neelsen (ZN) stain using 5% H 2 SO 4 was used to stain smears. They were examined by bright field microscopy by screening 200 oil immersion fields for oocysts of Cryptosporidium . [16]

All the samples were also tested for Cryptosporidum antigen by ELISA using Ridascreen (R.Biopharma, Darmstadt, Germany) as per manufacturers' instructions . DNA extraction was done from the samples positive for Cryptosporidium as described by Xiao and the DNA thus obtained was purified by using QIA amp DNA stool kit to remove inhibitors and was stored at -20 o C. Further genomic analysis was carried out by a two-step nested PCR protocol for amplification followed by RFLP analysis. [6]

A two-step nested PCR protocol was used to amplify the SSU rRNA gene using primers, which amplified sequences unique to all species of Cryptosporidium genus.

A PCR product of 1.3 kbp was amplified using forward. (5'TTCTAGAGCTAATACATGCG-3) and reverse (5' CCATTTCCTTCGAAACAGGA - 3') primers. Each PCR mixture (100 無 volume) contained 10 無 of 10x Taq Buffer, dNTP (10 mM each), primers 20 pM each, MgCl 1.5 mM, bovine serum albumin 0.01.mg, 2.5 U Taq polymerase and 2 無 of DNA template.

A total of 35 cycles each consisting of 94 o C for 45 seconds, 55 o C for 45 seconds and 72 o C for 60 seconds were performed with initial hot start at 94 o C for three minutes and a final extension step at 72 o C for seven minutes. For the secondary nested PCR step, a PCR product that was 836-849 bp long (depending on species) was amplified by using 2 無 of a primary PCR product and primers (5'GGAAGGGTTGTATTTATTAGATAAAG3') and (5'CTCATAAGGTGCTGAAGGAGTA -3). The PCR mixture and cycling conditions were identical to the conditions used for primary PCR except that the annealing temperature was at 58 o C.

Restriction fragment length polymorphism

For restriction fragment length analysis 20 無 of nested PCR product was digested in a 50 無 reaction mixture containing 10 units of Sspl or Vsp1 (Fermentas, Life science) for genotyping and 5 無 of appropriate restriction buffer at 37 o C overnight. The digested products were fractionated on a 2% agarose gel containing ethidium bromide at a concentration of 0.5 痢/mL.


 ~ Results Top


Out of 1485 faecal samples examined, 59 (4.0%) samples were positive for Cryptosporidium (51 by microscopy and ELISA, 8 by ELISA). Cryptosporidium was found in 52 out of 681 (7.6%) children and seven out of 804 (0.9%) of adults with diarrhoea. Highest prevalence was in the age group of six months - one year (14.3%). The prevalence progressively decreased with increasing age [Table - 1] and was very low (0.9%) in the adult population. The association between age and Cryptosporidium infection was found to be highly significant on statistical analysis (P <0.01). The youngest child to be infected in our study was one month old. Of the six bovine samples examined, only one (16.7%) was positive for Cryptosporidium .

All the microscopy positive samples appeared dark green to olive green in colour, watery or semi formed with foul odour. From four children with cryptosporidiosis, stool samples could be repeated every day. It was observed that as these samples became negative on microscopy the character of stool changed from watery green colour to formed yellow colour. There were no leukocytes or erythrocytes on microscopy.

Cryptosporidium
cases occurred through out the year, but highest prevalence was seen during the monsoon in the months of August and September [Figure - 1]. The duration of illness ranged from 3 to 30 days, the median duration was 4 days. There was no significant difference in infection rate among male (31) and female (28) cases. All cases were from families of low socioeconomic status. Tap water supplied by the municipal corporation was the only source of water. There was no correlation between the species isolated and contact with animals. No history of contact with animals could be elicited in the 13 cases in which C. parvum was detected. In four cases with history of contact with cattle, C. hominis was isolated.

Forty-two samples, 39 from children and three from adults were genotyped. C. parvum and C. hominis generated three visible bands of 447, 270 and 101 bp on Ssp1 digestion. The two species were differentiated by the vsp1 digestion pattern. C. parvum produced two visible bands of 627 and 115 bp. C. hominis generated two visible bands at 556 and 115 bp due to presence of one additional vsp1 restriction site [Figure - 2].

RFLP analysis of the nested PCR products showed that 29 (69.0%) were C. hominis , eight (19.0%) were C. parvum . Mixed infection with C. parvum and C. hominis was found in five (11.90%). Occurrence of mixed infection in these cases was confirmed by overnight digestion of nested PCR product using double the concentration of the enzymes. Only Cryptosporidium found in the bovines was identified as C. parvum .


 ~ Discussion Top


In the developing world, the association of Cryptosporidium with acute and persistent diarrhoea in children is striking. Several cross sectional studies in children with diarrhoea suggest that cryptosporidiosis is endemic in developing world with prevalence of up to 26% in Mexican and 16.5% in Brazilian children with diarrhoea. [4] Prevalence in African countries, Central and South American countries, Asian countries is greater than in Europe and North America. [16] In our study the prevalence in children under five years was 8.12 and 7.63% in children under 12 years. In the neighbouring countries of Pakistan and Indonesia the parasite has been found in 10.3 and 8.2% of children with diarrhoea respectively. [17],[18] In India, most of the earlier studies in paediatric diarrhoea were based on microscopic examination of faecal samples. The parasite was detected in 1.4% of cases of paediatric diarrhoea in North, 5.5% from East, 5.6% from West and 13.1% from South Indian children. [13],[14],[15]

Cryptosporidium has been reported in persons from three days to 95 years of age. But data suggest that young children are more susceptible to infection. [2] In our study, children in the age group of six months to one year were found to be the most vulnerable. This corresponds to the weaning period when the children are exposed to contaminated environment, food and water. Similar observations were made in Indonesia, Pakistan and Ghana where children less than 2 years old were found to be the most susceptible. [17],[18] In contrast, higher age group (4.5 years) was found to be the most susceptible in Kuwait. [9]

The duration of illness ranged from two days to 30 days. Median duration of diarrhoea was four days, which is similar to the report from a cohort study in Brazil in which the median number of days per diarrhoeal episode was three days. [4]

In tropical countries, prevalence of cryptosporidiosis is highest in rainy season. This could be due to contamination in surface waters in catchments areas following rains. Moreover oocysts of Cryptosporidium are sensitive to heat and resistant to chlorine. [2] Viable oocysts are likely to be present in more numbers in water during rainy season. Similarly in the present study cryptosporidiosis was found to be a seasonal disease. Highest number of cases occurred in the months of August and September when the rainfall is highest. Similar observations were made in Brazil and Indonesia. [4],[18] In Kuwait where rainfall is scanty highest prevalence was found in cool months of November to April. [9]

Development of molecular tools to identify morphologically indistinguishable species has played a key role in defining the relationship between parasite species, potential hosts and pathways of transmission. Even though the prevalence of cryptosporidiosis in tropical countries is high, limited studies have been conducted to characterize Cryptosporidium species from humans at molecular level. Characterization of Cryptosporidium isolates from Brazil, Malawi, Kenya, Vietnam and Peru have shown C. hominis to be the most prevalent indicating the predominance of anthroponotic transmission. [7],[10] There are no published reports on Cryptosporidium species identification from children in India. However, in South Indian HIV infected patients C. hominis was found to be the predominant species. [11] In this study also C. hominis was the most common species suggestive of anthroponotic transmission. In contrast, in Kuwait and England, zoonotic species C. parvum was found to be the most common species reported in 94% and 84% cases respectively indicating the importance of zoonotic transmission in these countries. [9],[8]

Other zoonotic species like C. meleagridis, C. felis and C. muris were also reported from children from Peru which were not found in our study. [10] However, C. parvum was found in 30.9% cases either singly (19.0%) or as mixed infection with C. hominis (11.9%) in this study. There was no correlation of species identified with animal contact and municipal tap water was the only source of water. Besides C. parvum was found in 16.6% of calves tested. In a study from rural area in Maharashtra five out of 13 calves tested were found to be shedding oocysts of C. parvum . [19] In Australia, 48.1% of calves were found to be infected with Cryptosporidium spp. when the infection appeared within one - three weeks after birth. [20] Genotyping of Cryptosporidium isolates from human cases from Kuwait and UK revealed zoonotic sources of infection involving livestock to be major route of transmission in humans. [8],[9]

Cattle rearing are a common occupation in urban and suburban areas of Andhra Pradesh. The occurrence of C. parvum in nearly one third of cases of cryptosporidiosis indicates zoonotic transmission to be of considerable significance in the epidemiology of Cryptosporidium in this State. In tropical countries, waterborne transmission is considered a major route in epidemiology of cryptosporidiosis. Similarly, water may be the major route of transmission of C. hominis and C. parvum genotypes which is evident from existence of significant proportion of mixed infections with C. parvum and C. hominis and the high prevalence during rainy season. Besides, there is no correlation of species identified and animal contact and municipal tap water was the only source of water. This shows the need for better protection of water catchments from livestock and improved drinking water treatment.

Further studies on characterization and subtyping of human, animal and environmental isolates are required to evaluate the public health significance of C. parvum infection in livestock, the exact sources and routes of transmission and population dynamics of Cryptosporidium . Control measures based on such knowledge shall be useful in reducing morbidity and mortality due to cryptosporidiosis in children.


 ~ Acknowledgement Top


This study was supported by a grant from Department of Biotechnology, Government of India, New Delhi (BT/PR/2716/MED). We thank LiHua Xiao of the CDC, Atlanta, USA, for supplying positive control slides and his expert guidance in this study.



 
 ~ References Top

1.Current WL, Garcia LS. Cryptosporidiosis . Clin Microbiol Rev 1991; 4: 325-58.  Back to cited text no. 1  [PUBMED]  [FULLTEXT]
2.Fayer R . Cryptosporidium: A water borne zoonotic parasite. Vet Parasitol 2004 ;126: 37-56.  Back to cited text no. 2    
3.Mac Kenzie WR, Hoxie NJ, Procter ME, Gradus MS, Blair KA, Peterson DE, et al . A massive outbreak in Milwaukee of Crytposporidium infection transmitted through the public water supply. N Eng J Med 1994 ;331: 161-7.  Back to cited text no. 3    
4.Newman RD, Sears CL, Moore SR, Nataro JP, Wuhib T, Agnew DA, et al . Longitudinal study of Cryptosporidium infection in children in northeastern Brazil. J Infect Dis 1999; 180: 167-75.  Back to cited text no. 4  [PUBMED]  [FULLTEXT]
5.Xia L, Fayer R, Ryan U, Upton SJ. Cryptosporidium taxonomy: Recent advances and implications for public health. Clin Microbiol Rev 2004; 17: 72-97.  Back to cited text no. 5    
6.Xiao L, Morgan UM, Limor J, Escalante A, Arrowood M, Shulaw W, et al . Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl Environ Microbiol 1999; 65: 3386-91.  Back to cited text no. 6  [PUBMED]  [FULLTEXT]
7.Gatei W, Greensill J, Ashford RW, Cuevas LE, Parry CM, Cunliffe NA, et al . Molecular analysis of 18s r RNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, The United Kingdom and Vietnam. J Clin Microbiol 2003; 41: 1458-62.  Back to cited text no. 7  [PUBMED]  [FULLTEXT]
8.Goh S, Reacher M, Cassemore DP, Verlande NQ, Chalmers R, Knowles M, et al . Sporadic Cryptosporidiosis , North Cumbria, England, 1996-2000. Emerg Infect Dis 2004; 10 :1007-15 .   Back to cited text no. 8    
9.Sulaiman IM, Hira PR, Zhou I, Al-Ali FM Shelahi FA, Shweiki HM, Iqbal J, et al . Unique endemicity of Cryptosporidiosis in children in Kuwait. J Clin Microbiol 2005; 43: 2805-9.  Back to cited text no. 9    
10.Xiao L, Bern C, Limor J, Sulaiman I, Roberts J, Checkley W, et al . Identification of 5 types of Cryptosporidium parasites in Children in Lima, Peru. J Infect Dis 2001; 183: 492-7.   Back to cited text no. 10  [PUBMED]  [FULLTEXT]
11.Muthusamy D, Rao SS, Ramani S, Monica B, Banerjee I, Abraham OC, et al . Multilocus genotyping of Cryptosporidium sp . isolates from human immunodeficiency virus-infected individuals in South India. J Clin Microbiol 2006; 44: 632-4.  Back to cited text no. 11    
12.Pieniazek NJ, Bornay-Llinares FJ, Slemenda SB, Alexander da Silva J, Moura IN, Arrowood MJ, et al . New cryptosporidium genotypes in HIV infected persons. Emerg Infect Dis 1999; 5: 444-9.  Back to cited text no. 12    
13.Sehgal R, Rai SK, Sharma P, Malla N, Ganguly NK, Walia BN, et al . Cryptosporidium as a cause of diarrhoea in children. Indian J Med Microbiol 1989; 7: 130-3.  Back to cited text no. 13    
14.Saraswathi K, Pandit DV, Deodhar LP, Bichiles LS. Prevalence of Cryptosporidia in patients with diarrhoea in Bombay . Indian J Med Res 1988; 87: 221-4.  Back to cited text no. 14    
15.Mathan MM, Venkatesan S, George R, Mathew M, Mathan VI . Cryptosporidium and diarrhoea in southern Indian children. Lancet 1985; 2 :1172-5.  Back to cited text no. 15    
16.Garcia LS, Bruckner DA, Brewer TC, Shimizu RY. Techniques for the recovery and identification of Cryptosporidiuum oocysts from stool specimens. J Clin Microbiol 1983; 18: 185-90.  Back to cited text no. 16  [PUBMED]  [FULLTEXT]
17.Iqbal J, Munir MA, Khan MA . Cryptosporidium infection in young children with diarrhea in Rawalpindi, Pakistan. Am J Trop Med Hyg 1999; 60 :868-70.  Back to cited text no. 17    
18.Katsumata T, Hosea D, Wasito EB, Kohno S, Soeparto P, Ranuh IG . Cryptosporidiosis in Indonesia: A hospital based study and a community based survey. Am J Trop Med Hyg 1998; 59: 628-32.  Back to cited text no. 18    
19.Khubnani H, Sivarajan K, Khubnani AH . Study of Cryptosporidiosis in a rural area of Maharashatra . Indian J Patho Microbiol 199 7; 40:33-6.  Back to cited text no. 19    
20.Becher KA, Robertson ID, Fraser DM, Palmer DG, Thompson RC. Molecular epidemiology of Giardia and Cryptosporidium infections in dairy calves originating from three sources in Western Australia . Vet Parasitol 2004; 123: 1-9.  Back to cited text no. 20  [PUBMED]  [FULLTEXT]


    Figures

  [Figure - 1], [Figure - 2]
 
 
    Tables

  [Table - 1]

This article has been cited by
1 Comparative Diagnostic Techniques for Cryptosporidium Infection
Beauty Omoruyi,Uchechukwu Nwodo,Chukwuneke Udem,Francis Okonkwo
Molecules. 2014; 19(2): 2674
[Pubmed] | [DOI]
2 Genetic diversity of Cryptosporidium isolates from patients in North India
Poonam Sharma,Aman Sharma,Rakesh Sehgal,Nancy Malla,Sumeeta Khurana
International Journal of Infectious Diseases. 2013; 17(8): e601
[Pubmed] | [DOI]
3 Antigen based diagnosis of Cryptosporidium parvum infection in faeces of cattle and buffalo calves
Singla, L.D. and Gupta, M.P. and Singh, H. and Singh, S.T. and Kaur, P. and Juyal, P.D.
Indian Journal of Animal Sciences. 2013; 83(1): 37-39
[Pubmed]
4 Prevalence of rotavirus, coronavirus and escherichia coli: The main agents responsible for calf diarrhoea
Suresh, T. and Rai, R.B. and Dhama, K. and Bhatt, P. and Sawant, P.M. and Sharma, A.K.
Veterinary Practitioner. 2012; 13(2): 160-165
[Pubmed]
5 Serum IgG responses and seroconversion patterns to cryptosporidium gp15 among children in a birth cohort in south India
Sarkar, R. and Ajjampur, S.S.R. and Muliyil, J. and Ward, H. and Naumova, E.N. and Kang, G.
Clinical and Vaccine Immunology. 2012; 19(6): 849-854
[Pubmed]
6 Cryptosporidium and cryptosporidiosis of man and animals in India
Chhabra, M.B. and Pathak, K.M.L.
Indian Journal of Animal Sciences. 2012; 82(2): 142-150
[Pubmed]
7 Serum IgG response to Cryptosporidium immunodominant antigen gp15 and polymorphic antigen gp40 in children with cryptosporidiosis in South India
Ajjampur, S.S.R., Sarkar, R., Allison, G., Banda, K., Kane, A., Muliyil, J., Naumova, E., (...), Kang, G.
Clinical and Vaccine Immunology. 2011; 18(4): 633-639
[Pubmed]
8 Detection and differentiation of Cryptosporidium spp. in human clinical samples by use of real-time PCR
Hadfield, S.J., Robinson, G., Elwin, K., Chalmers, R.M.
Journal of Clinical Microbiology. 2011; 49(3): 918-924
[Pubmed]
9 Intestinal coccidian parasitic infections in rural community in and around Loni, Maharashtra
A. K. Gupta
Journal of Parasitic Diseases. 2011;
[VIEW] | [DOI]
10 Coproantigen detection of Cryptosporidium parvum infection in cattle in and around Bangalore
Veena, M. and D漀ouza, P.E. and Rathnamma, D.
Journal of Veterinary Parasitology. 2011; 25(2): 181-182
[Pubmed]
11 Enteric pathogens associated with childhood diarrhea in Tripoli-Libya
Rahouma, A. and Klena, J.D. and Krema, Z. and Abobker, A.A. and Treesh, K. and Franka, E. and Abusnena, O. and Shaheen, H.I. and El Mohammady, H. and Abudher, A. and Ghenghesh, K.S.
American Journal of Tropical Medicine and Hygiene. 2011; 84(6): 886-891
[Pubmed]
12 Etiology of diarrhea in older children, adolescents and adults: A systematic review
Walker, C.L.F. and Sack, D. and Black, R.E.
PLoS Neglected Tropical Diseases. 2010; 4(8)
[Pubmed]
13 Multisite study of cryptosporidiosis in children with diarrhea in India
Ajjampur, S.S.R. and Liakath, F.B. and Kannan, A. and Rajendran, P. and Sarkar, R. and Moses, P.D. and Simon, A. and Agarwal, I. and Mathew, A. and O潢onnor, R. and Ward, H. and Kang, G.
Journal of Clinical Microbiology. 2010; 48(6): 2075-2081
[Pubmed]
14 Frequency of cryptosporidium infection in children under five years of age having diarrhea in the North West of Pakistan
Mumtaz, S., Ahmed, J., Ali, L.
African Journal of Biotechnology. 2010; 9(8): 1230-1235
[Pubmed]
15 Etiology of diarrhea in older children, adolescents and adults: A systematic review
Walker, C.L.F., Sack, D., Black, R.E.
PLoS Neglected Tropical Diseases. 2010; 4(8): art -e768
[Pubmed]
16 Multisite study of cryptosporidiosis in children with diarrhea in India
Ajjampur, S.S.R., Liakath, F.B., Kannan, A., Rajendran, P., Sarkar, R., Moses, P.D., Simon, A., (...), Kang, G.
Journal of Clinical Microbiology. 2010; 48(6): 2075-2081
[Pubmed]
17 High resolution melting-curve (HRM) analysis for the diagnosis of cryptosporidiosis in humans
Pangasa, A., Jex, A.R., Campbell, B.E., Bott, N.J., Whipp, M., Hogg, G., Stevens, M.A., Gasser, R.B.
Molecular and Cellular Probes. 2009; 23(1): 10-15
[Pubmed]
18 High resolution melting-curve (HRM) analysis for the diagnosis of cryptosporidiosis in humans
Aradhana Pangasa,Aaron R. Jex,Bronwyn E. Campbell,Nathan J. Bott,Margaret Whipp,Geoff Hogg,Melita A. Stevens,Robin B. Gasser
Molecular and Cellular Probes. 2009; 23(1): 10
[Pubmed] | [DOI]
19 Cryptosporidium species in HIV-infected individuals in India: An overview
Sankaran, P., Kang, G.
National Medical Journal of India. 2008; 21(4): 178-184
[Pubmed]



 

Top
Print this article  Email this article
Previous article Next article

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04