Indian Journal of Medical Microbiology Home 

BRIEF COMMUNICATION
[Download PDF]
Year : 2018  |  Volume : 36  |  Issue : 4  |  Page : 569--571

Sub-inhibitory concentration of ertapenem induces overexpression of regulator of antibiotic resistance A in Escherichia coli

Shiela Chetri1, Kabita Singha1, Deepshikha Bhowmik1, Debadatta Dhar Chanda2, Atanu Chakravarty2, Amitabha Bhattacharjee1,  
1 Department of Microbiology, Assam University, Silchar, Assam, India
2 Department of Microbiology, Silchar Medical College and Hospital, Silchar, Assam, India

Correspondence Address:
Dr. Amitabha Bhattacharjee
Department of Microbiology, Assam University, Silchar, Assam
India

Abstract

AcrAB-TolC is a tripartite efflux pump system constitutively expressed which functions as an intrinsic-resistant mechanism found to be responsible for conferring resistance towards dyes, detergents and different compounds including various classes of antibiotics. One global regulator belonging to AraC-type regulator family, regulator of antibiotic resistance A (RarA) up-regulates the expression of AcrAB-TolC encoded in Klebsiella pneumoniae, Enterobacter sp. 638, Serratia proteamaculans 568 and Enterobacter cloacae resulting in multidrug-resistant phenotypes. The present work was initiated to find out the transcriptional response of RarA in clinical isolates of Escherichia coli against concentration gradient carbapenem stress. A total of 22 clinical isolates of E. coli and expression level of regulators were analysed via quantitative real-time polymerase chain reaction with and without carbapenem stress. As a result, a strong correlation between the expressional levels of RarA in AcrAB overexpressed isolates of E. coli and elevated expression was observed when exposed under concentration gradient ertapenem stress. The clones containing pRar showed reduction in the zone of inhibition towards carbapenem, indicating the active participation of RarA in AcrAB overexpressed isolates of E. coli conferring resistance towards carbapenems.

How to cite this article:
Chetri S, Singha K, Bhowmik D, Chanda DD, Chakravarty A, Bhattacharjee A. Sub-inhibitory concentration of ertapenem induces overexpression of regulator of antibiotic resistance A in Escherichia coli.Indian J Med Microbiol 2018;36:569-571

How to cite this URL:
Chetri S, Singha K, Bhowmik D, Chanda DD, Chakravarty A, Bhattacharjee A. Sub-inhibitory concentration of ertapenem induces overexpression of regulator of antibiotic resistance A in Escherichia coli. Indian J Med Microbiol [serial online] 2018 [cited 2019 Dec 6 ];36:569-571
Available from: http://www.ijmm.org/text.asp?2018/36/4/569/254400

Full Text

 Introduction



In Gram-negative bacteria, the presence of cell wall creates permeability barrier which confers intrinsic resistance to a wide variety of antibiotics.[1],[2] In addition to that, bacteria are much efficient in the removal of drugs through up-regulation of efflux pumps and acquisition of resistance genes, which makes it multidrug resistance (MDR).[2],[3],[4],[5] In Escherichia coli, efflux pump plays a significant role in conferring resistance towards various agents regulated via specific regulators in response to the external signal provided. AcrAB-TolC efflux pump system belonging to RND superfamily is the tripartite system found in E. coli[6] co-ordinated by local regulator AcrR [7] and global regulators MarA, SoxS and Rob.[8] It is previously reported that the expression of AcrR is found to be induced under general stress condition and linked with the overexpression of AcrAB efflux pump in E. coli.[7] According to a study done by Veleba et al., 2012, a novel AraC-type regulator was identified and characterized called regulator of antibiotic resistance A (RarA) that confers MDR phenotype and encodes a regulator in Klebsiella pneumoniae, Enterobacter sp. 638, Serratia proteamaculans 568 and Enterobacter cloacae subsp. cloacae.[9] Efflux pump-mediated tigecycline resistance is influenced by RarA, and increase in RarA expression is linked with the expression of OqxAB efflux pump.[10] It is of interest to know how this regulator responds against carbapenem antibiotics, which are known to be the last therapeutic option against all Gram-negative infections. Therefore, in the present study, transcriptional response of RarA against concentration gradient carbapenem stress was investigated.

 Methodology



A total of 22 AcrAB-TolC overexpressed clinical isolates of E. coli [Supplementary Table S1] that were devoid of any known carbapenemase genes were selected for the study. Quantitative real-time polymerase chain reaction (PCR) was carried out to investigate the transcriptional level of the regulatory gene RarA in AcrAB efflux pump overexpressed isolates of E. coli. RNA was extracted using a Qiagen RNase Mini Kit (Qiagen, Germany); then, for cDNA synthesis, QuantiTect ® reverse transcription kit (Qiagen, Germany) was used. The cDNAs were quantified by real-time PCR amplification with specific primers (RarA F: CTATCGAAGCCGGGCATCTG and RarA R: CGGCAGAAATACGTTCCACA) using a Power SYBR Green Master Mix Kit (Applied Biosystems, USA) on a OneStepPlus Real-Time PCR System (Applied Biosystems, USA). Each sample was processed in triplicates and their relative expression was detected by ΔΔct method compared with that of E. coli ATCC 25922. To assess the response of RarA against carbapenem stress, isolates were exposed to sub-inhibitory concentrations of meropenem, ertapenem and imipenem ranging from 0.25 to 2 μg/ml. The global regulatory gene RarA was quantified by real-time PCR assay as mentioned earlier. To investigate carbapenem susceptibility, PCR amplification of RarA using specific primers (RarA WF: GGCGTCACGGTAGATGATCAAC and RarA WR: CCTGCGACCACAGGGATACATT) was performed using 50 μl of total reaction volume. The PCR products were then confirmed by 1.0% (w/v) agarose gels and purified using the Qiaquick ® Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into pGEMT-vector (Promega, Madison, USA). The resulting recombinant plasmids (pRar) were transformed into E. coli DH5α strain by heat shock method for functional characterization. Antimicrobial susceptibility testing and minimum inhibitory concentration (MIC) of the clones were determined against meropenem, ertapenem and imipenem by agar dilution method.[INLINE:1]

 Results



Of 22 carbapenem non-susceptible E. coli isolates, elevation in the expression of RarA was observed in 14 isolates. While analysing the concentration gradient stress response, it was observed that an increasing concentration of ertapenem is directly proportional to the expression of RarA. However, under meropenem and imipenem stress, no such significant alteration in the expression was observed against different gradient of concentrations [Figure 1]. Antimicrobial susceptibility testing and MIC determination of the clones (pRarA) for investigation of the role of RarA gene in carbapenem resistance revealed decrease in the zone of inhibition against ertapenem compared with that of the parent strain (DH5α) and more than three-fold increase in the MIC of clone against ertapenem compared with the parent strain and wild type, respectively [Table 1].{Figure 1}{Table 1}

 Discussion and Conclusion



Multidrug efflux pump is a well-known intrinsic resistance mechanism conferring resistance towards a wide variety of agents including dyes, detergents, ethidium bromide, sodium dodecyl sulphate, crystal violet, bile acids and various classes of antibiotics in E. coli.[11] As previously published, AcrAB-TolC, the most commonly found tripartite efflux pump system, is responsible for developing MDR phenotype in E. coli.[6] There are reports that the expression of AcrAB-TolC efflux pump is regulated by local regulator AcrR [7] and global regulators such as MarA, SoxS and Rob.[8] In addition to these regulators, the multidrug efflux pump has also been influenced by the expression of RarA and RamA found in K. pneumoniae, Enterobacter sp., S. proteamaculans and E. cloacae subsp. cloacae associated with tigecycline resistance.[9] This study was undertaken to investigate the role of RarA in E. coli under carbapenem exposure. The expression of RarA in AcrAB overexpressed isolates was found to be induced under ertapenem pressure was observed in the present study. The study of Veleba and Schneiders, 2012 suggests that plasmid-mediated overexpression of RarA that act as a positive regulator of AcrAB to produce MDR [10] in either E. coli or K. pneumoniae is independent of MarA, SoxS and Rob [11] but requires a functional AcrAB efflux pump system which is in agreement with the present study. Pérez et al., 2012 observed a strong correlation between macrolides, tetracycline, ketolides, fluoroquinolones and chloramphenicol with overexpression of AcrAB efflux pump system along with SoxS, RobA and RamA.[12] To confirm the role of RarA in efflux pump-mediated carbapenem resistance, clone of RarA was subjected to antibiotic susceptibility testing and MIC determination which further supported the claim. The decrease in the susceptibility shown by RarA clone may be due to the up-regulation of the transcriptional regulatory protein RarA in clinical isolates of E. coli is unique and warrants further investigation.

Acknowledgements

The authors would like to thank DBT-NER Twinning Programme (File no. BT/517/NE/TBP/2013), Government of India. We would like to acknowledge Assam University Biotech Hub for providing infrastructure facility.

Financial support and sponsorship

The study was supported by DBT-NER Twinning Programme (File no. BT/517/NE/TBP/2013), Government of India.

Conflicts of interest

There are no conflicts of interest.

References

1Nikaido H. Molecular basis of bacterial outer membrane permeability revisited. Microbiol Mol Biol Rev 2003;67:593-656.
2Zgurskaya HI, Löpez CA, Gnanakaran S. Permeability barrier of Gram-negative cell envelopes and approaches to bypass it. ACS Infect Dis 2015;1:512-22.
3Pagès JM, James CE, Winterhalter M. The porin and the permeating antibiotic: A selective diffusion barrier in Gram-negative bacteria. Nat Rev Microbiol 2008;6:893-903.
4Li XZ, Plésiat P, Nikaido H. The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria. Clin Microbiol Rev 2015;28:337-418.
5Nikaido H, Pagès JM. Broad-specificity efflux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS Microbiol Rev 2012;36:340-63.
6Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE, et al. Molecular cloning and characterization of AcrA and AcrE genes of Escherichia coli. J Bacteriol 1993;175:6299-313.
7Ma D, Alberti M, Lynch C, Nikaido H, Hearst JE. The local repressor AcrR plays a modulating role in the regulation of AcrAB genes of Escherichia coli by global stress signals. Mol Microbiol 1996;19:101-12.
8Gallegos MT, Schleif R, Bairoch A, Hofmann K, Ramos JL. Arac/XylS family of transcriptional regulators. Microbiol Mol Biol Rev 1997;61:393-410.
9Veleba M, Higgins PG, Gonzalez G, Seifert H, Schneiders T. Characterization of RarA, a novel AraC family multidrug resistance regulator in Klebsiella pneumoniae. Antimicrob Agents Chemother 2012;56:4450-8.
10Veleba M, Schneiders T. Tigecycline resistance can occur independently of the RamA gene in Klebsiella pneumoniae. Antimicrob Agents Chemother 2012;56:4466-7.
11Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE, et al. Genes AcrA and AcrB encode a stress-induced efflux system of Escherichia coli. Mol Microbiol 1995;16:45-55.
12Pérez A, Poza M, Aranda J, Latasa C, Medrano FJ, Tomás M, et al. Effect of transcriptional activators SoxS, RobA, and RamA on expression of multidrug efflux pump AcrAB-tolC in Enterobacter cloacae. Antimicrob Agents Chemother 2012;56:6256-66.