Indian Journal of Medical Microbiology Home 

ORIGINAL ARTICLE
[Download PDF]
Year : 2018  |  Volume : 36  |  Issue : 4  |  Page : 537--540

Transcriptional response of AcrEF-TolC against fluoroquinolone and carbapenem in Escherichia coli of clinical origin

Shiela Chetri1, Anutee Dolley1, Deepshikha Bhowmik1, Debadatta Dhar Chanda2, Atanu Chakravarty2, Amitabha Bhattacharjee1,  
1 Department of Microbiology, Assam University, Silchar, Assam, India
2 Department of Microbiology, Silchar Medical College and Hospital, Silchar, Assam, India

Correspondence Address:
Dr. Amitabha Bhattacharjee
Department of Microbiology, Assam University, Silchar, Assam
India

Abstract

Introduction: Efflux pump systems constitute a major means of intrinsic resistance in Escherichia coli. AcrEF-TolC pump is known to exhibit higher expression level in quinolone resistant isolates. However, the transcriptional response of this pump is yet to be known when exposed to quinolone and other group of antibiotics. Objective: The present study analyses the transcriptional response of AcrEF-TolC in the presence of quinolones and carbapenems. Methodology: A total of 167 non-duplicate clinical isolates from Silchar medical college and Hospital, Silchar, India were included in this study. Of which 27 were devoid of any carbapenemase activity and among them 13 isolates showed overexpression of AcrE and AcrF gene. Transcriptional response of AcrE was directly proportional to increasing concentration of levofloxacin and ofloxacin. However, the response of AcrE and AcrF was inconsistent with carbapenems. Result: The study isolates showed susceptibility towards amikacin (68.4%), gentamicin (59.6%), cefepime (52.7%) and pipercillin/tazobactam (48.3%). The present investigation highlights that apart from qnr genes and mutational changes in gyr region, AcrEF-TolC plays a major role in fluoroquinolone resistance in this part of the world. Conclusion: Upregulation of AcrE in the presence of levofloxacin and ofloxacin warrants further investigation to establish their active role in efflux of this drug.

How to cite this article:
Chetri S, Dolley A, Bhowmik D, Chanda DD, Chakravarty A, Bhattacharjee A. Transcriptional response of AcrEF-TolC against fluoroquinolone and carbapenem in Escherichia coli of clinical origin.Indian J Med Microbiol 2018;36:537-540

How to cite this URL:
Chetri S, Dolley A, Bhowmik D, Chanda DD, Chakravarty A, Bhattacharjee A. Transcriptional response of AcrEF-TolC against fluoroquinolone and carbapenem in Escherichia coli of clinical origin. Indian J Med Microbiol [serial online] 2018 [cited 2019 Aug 22 ];36:537-540
Available from: http://www.ijmm.org/text.asp?2018/36/4/537/254393

Full Text

 Introduction



In Escherichia coli, the major tripartite efflux pump system found to be responsible for the high intrinsic level of antibiotic resistance is AcrAB-TolC.[1] All the three components are required to generate multidrug-resistant phenotype and mutations in these proteins may lead to alteration in the susceptibility pattern towards various antimicrobial agents.[2] This complex can pump out various compounds, dyes and detergents including various classes of antimicrobials.[3] Besides, the AcrEF operon also encodes an efflux pump, in which AcrE and AcrF are highly homologous to AcrA and AcrB,[4] respectively, whereas AcrE shares 65% amino acid identity with AcrA, and AcrF shares 77% identity with AcrB.[5] In a study by Kawamura-Sato et al., 1999 E. coli strains overexpressing AcrEF,[6] increased resistance for compounds such as dyes, detergents and antibiotic substrates like that of AcrAB was determined. However, under laboratory conditions, the expression of AcrEF is very low,[7] but deletion of AcrEF causes no such alterations in the phenotypic characteristics in E. coli.[8] The expression of AcrEF was found to be repressed by the product of the AcrS gene [9] that is a transcriptional regulator belonging to the TetR/AcrR family of proteins. It was observed that inactivation of AcrS was not sufficient to induce AcrEF expression in Salmonella enterica.[10] In E. coli, efflux pumps are the efficient drug transporter systems, and it was reported that fluoroquinolones which acts as substrate for many efflux pumps, such as RND efflux pump family members AcrAB-TolC and AcrEF-TolC and MATE family members NorE.[11],[12] These pumps function as primary mechanisms of multiple drug resistance when activated. Fluoroquinolone and carbapenems are often used for therapeutic alternatives in community and hospital infections in this part of the world. Therefore, the present study aims to detect transcriptional response of AcrEF-TolC against concentration gradient stress of quinolone and carbapenems among selected isolates of E. coli.

 Methodology



Bacterial isolates

E. coli isolates selected for the study were collected from Silchar Medical College and Hospital, Silchar, Assam, India, between August 2016 and July 2017. Isolates were selected based on resistance to at least one of the carbapenems (meropenem, ertapenem and imipenem) and levofloxacin and ofloxacin.

Phenotypic screening of efflux pump-mediated carbapenem and quinolone resistance

The selected isolates were screened for efflux pump-mediated carbapenem and quinolone resistance using meropenem (10 μg), levofloxacin (5 μg) and ofloxacin (5 μg) alone and in combination with an efflux pump inhibitor carbonyl cyanide m-chlorophenylhydrazone (12.5 μM) (HiMedia, Mumbai, India). A difference between zone of inhibition of ≥5 mm with the inhibitor and the antibiotic alone taken as screened positive organism.[13]

Detection of carbapenemase activity

To avoid the interference of any carbapenemase genes, Modified Hodge test was performed to verify the carbapenemase activity in the selected isolates. To further confirm the absence of carbapenemase genes, polymerase chain reaction (PCR) was carried out in a 96-well thermal cycler (Applied Biosystems) for carbapenemase genes which included blaNDM, blaVIM, blaKPC, blaIMP, blaOXA −23, blaOXA −48 and blaOXA −58.[14],[15],[16],[17]

Antimicrobial susceptibility testing and minimum inhibitory concentration determination

Antimicrobial susceptibility testing was performed by Disc diffusion method against various antibiotics including-ciprofloxacin (5 μg), amikacin (30 μg), cefepime (30 μg), aztreonam (30 μg), ceftriaxone (30 μg), cotrimoxazole (25 μg), ceftazidime (30 μg), levofloxacin (5 μg), gentamicin (10 μg), carbenicillin (10 μg), polymyxin B (300 units), Colistin (10 μg), ceftazidime (30 μg) and piperacillin-tazobactam (100/10 μg) (Hi-media, Mumbai, India) and the results were interpreted as per CLSI guidelines 2017.[13] The minimum inhibitory concentrations (MICs) of carbapenems (meropenem, ertapenem and imipenem) and levofloxacin and ofloxacin were determined by agar dilution method, and the results were interpreted using CLSI guidelines.[13] E. coli ATCC 25922 was used as quality control.

Relative quantification of AcrEF efflux pump expression by quantitative real-time polymerase chain reaction

Transcriptional expression of the targeted efflux pump genes AcrE and AcrF was measured through QIAGEN Rneasy Mini Kit (QIAGEN, Germany) using total RNA extracted from overnight culture. RNA was reverse transcribed into complementary DNA through QIAGEN Reverse Transcription Kit (QIAGEN, Germany) and was quantified by Picodrop (pico200, Cambridge, UK). Quantitative real-time PCR was performed using Power Sybrgreen master mix reagents kit (Applied Biosystems, Austin, USA) in a StepOnePlus Quantitative Real Time-PCR (Applied Biosystems, USA) using specific primers AcrE (F): AACCGCAGGTTACCGTTCAT, AcrE (R): CGGGATCGTACTGAATCGCA and AcrF (F): GAAACCGTGGGAAGAGCGTA, AcrF (R): CCATTGTTGAACTGGGCACG. Gene expression was calculated using the ΔΔCT method and all samples were normalised using E. coli ATCC 25922 as an internal control and Rpsl as an exogenous control.

Transcriptional expression of AcrEF efflux pump under concentration gradient quinolone and carbapenem stress condition

The expression level of the efflux pump genes AcrE and AcrF were further examined after antibiotic exposure of meropenem (AstraZeneca UK Limited), ertapenem (MSD Pharmaceuticals Pvt. Ltd., India), imipenem (Hetero Labs Limited, India), levofloxacin (Micro Labs Limited, Bengaluru, India) and ofloxacin (Micro Labs Limited, Bengaluru, India) at concentrations ranging from 0.25 and 2 μg/ml by quantitative real-time PCR. The primers and the reaction conditions are as described above.

 Results



Of 167 clinical isolates of multidrug-resistant E. coli, 57 were showing efflux pump-mediated carbapenem or quinolone resistance by an inhibitor-based method. Among them, 27 were found to be devoid of any carbapenemase activity, were selected for the further study. MIC of most of the isolates was found to be above break point against carbapenems and studied quinolones [Table 1]. Among these 27 isolates, 13 showed overexpression of AcrE and AcrF when compared with E. coli ATCC 25922 [Figure 1]. Further, the transcriptional expression of AcrE was directly proportional to the increasing concentration of levofloxacin and ofloxacin [Figure 2]. Whereas the expression level of AcrF gene under levofloxacin showed an asymmetrical setup [Figure 3] but under ofloxacin stress a decrease in the expression of AcrF gene up to a particular concentration (1 μg/ml) then a substantial increase in the expression level with increase in concentration was noticed [Figure 3]. AcrE under carbapenem stress shown in consistent result. With ertapenem, transcriptional expression increased at 1 μg/mL and subsequently an increasing pattern was observed. Imipenem showed a consistent pattern of expression independent of the concentration gradient. However, in case of meropenem decrease in expression was observed at 1 μg/ml, besides there was a constant elevation in expression [Figure 4]. In case of AcrF, there is no significant alteration in the expression pattern when the isolates were exposed to concentration gradient imipenem and meropenem stress. However, response against ertapenem was random without any specific trend [Figure 5]. The study isolates showed susceptibility towards amikacin (68.4%), gentamicin (59.6%), cefepime (52.7%) and piperacillin/tazobactam (48.3%).{Table 1}{Figure 1}{Figure 2}{Figure 3}{Figure 4}{Figure 5}

Author contributions

SC performed the experimental work, data collection and analysis and prepared the manuscript. DB analyzed the data. DD and AC have designed the work plan. AB has conceived the plan and supervised the whole study.

 Discussion



In the present study, overexpression of AcrEF-TolC was observed in 13 E. coli isolates which were also having a quinolone and carbapenem-resistant phenotype. A similar finding was observed in a previous study where enhanced efflux was observed in isolates with increased AcrEF expression.[18] In addition, an increase in expression of AcrF was detected in E. coli that had a MIC above the breakpoint for ciprofloxacin, levofloxacin and norfloxacin in a study conducted in Japan.[19] However, as per our knowledge, no study has attempted to analyse the transcriptional response of AcrEF-TolC under differential concentration gradient stress of quinolones. In the study, we selected levofloxacin and ofloxacin for stress analysis as these two antibiotics are being prescribed mostly due to their broad range of activity.[20],[21] The study shows an increasing pattern of transcriptional expression of AcrE against an increasing concentration of levofloxacin and ofloxacin whereas the same pattern was not noticed in case of AcrF. Thus, the expression of AcrE probably being induced in the presence of quinolone. However, no previous study could be found in the support of our finding. In the present study, no correlation of carbapenem resistance within AcrEF-TolC expression could be established. Although further investigation is required. Probably, this RND efflux pump system does not have any role in carbapenem resistance.

 Conclusion



The present study highlights that besides qnr genes and mutational changes in gyr region, AcrEF-TolC plays a major role in fluoroquinolone resistance in this part of the world. The upregulation of AcrE in the presence of levofloxacin and ofloxacin warrants further investigation to establish their active role in efflux of this drug.

Financial support and sponsorship

The study was supported by DBTNER Twinning Programme (File no. BT/517/NE/TBP/2013), Government of India.

Conflicts of interest

There are no conflicts of interest.

References

1Nikaido H, Zgurskaya HI. AcrAB and related multidrug efflux pumps of Escherichia coli. J Mol Microbiol Biotechnol 2001;3:215-8.
2Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE, et al. Genes AcrA and AcrB encode a stress-induced efflux system of Escherichia coli. Mol Microbiol 1995;16:45-55.
3Okusu H, Ma D, Nikaido H. AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. J Bacteriol 1996;178:306-8.
4Kobayashi K, Tsukagoshi N, Aono R. Suppression of hypersensitivity of Escherichia coli AcrB mutant to organic solvents by integrational activation of the AcrEF operon with the IS1 or IS2 element. J Bacteriol 2001;183:2646-53.
5Smith HE, Blair JM. Redundancy in the periplasmic adaptor proteins AcrA and AcrE provides resilience and an ability to export substrates of multidrug efflux. J Antimicrob Chemother 2014;69:982-7.
6Kawamura-Sato K, Shibayama K, Horii T, Iimuma Y, Arakawa Y, Ohta M, et al. Role of multiple efflux pumps in Escherichia coli in indole expulsion. FEMS Microbiol Lett 1999;179:345-52.
7Lau SY, Zgurskaya HI. Cell division defects in Escherichia coli deficient in the multidrug efflux transporter AcrEF-TolC. J Bacteriol 2005;187:7815-25.
8Sulavik MC, Houseweart C, Cramer C, Jiwani N, Murgolo N, Greene J, et al. Antibiotic susceptibility profiles of Escherichia coli strains lacking multidrug efflux pump genes. Antimicrob Agents Chemother 2001;45:1126-36.
9Nishino K, Yamaguchi A. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J Bacteriol 2001;183:5803-12.
10Olliver A, Vallé M, Chaslus-Dancla E, Cloeckaert A. Overexpression of the multidrug efflux operon AcrEF by insertional activation with IS1 or IS10 elements in Salmonella enterica serovar typhimurium DT204 AcrB mutants selected with fluoroquinolones. Antimicrob Agents Chemother 2005;49:289-301.
11Yang S, Clayton SR, Zechiedrich EL. Relative contributions of the AcrAB, MdfA and NorE efflux pumps to quinolone resistance in Escherichia coli. J Antimicrob Chemother 2003;51:545-56.
12Swick MC, Morgan-Linnell SK, Carlson KM, Zechiedrich L. Expression of multidrug efflux pump genes AcrAB-TolC, MdfA, and NorE in escherichia coli clinical isolates as a function of fluoroquinolone and multidrug resistance. Antimicrob Agents Chemother 2011;55:921-4.
13Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, Supplement M100. 27th ed. Wayne, PA: Clinical and Laboratory Standards Institute; 2017.
14Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-beta-lactamase gene, bla (NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 2009;53:5046-54.
15Yum JH, Yi K, Lee H, Yong D, Lee K, Kim JM, et al. Molecular characterization of metallo-beta-lactamase-producing Acinetobacter baumannii and Acinetobacter genomospecies 3 from Korea: Identification of two new integrons carrying the bla (VIM-2) gene cassettes. J Antimicrob Chemother 2002;49:837-40.
16Shibl A, Al-Agamy M, Memish Z, Senok A, Khader SA, Assiri A, et al. The emergence of OXA-48- and NDM-1-positive Klebsiella pneumoniae in Riyadh, Saudi Arabia. Int J Infect Dis 2013;17:e1130-3.
17Mendes RE, Bell JM, Turnidge JD, Castanheira M, Jones RN. Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. In Asia-pacific nations: Report from the SENTRY surveillance program. J Antimicrob Chemother 2009;63:55-9.
18Jellen-Ritter AS, Kern WV. Enhanced expression of the multidrug efflux pumps AcrAB and AcrEF associated with insertion element transposition in Escherichia coli mutants selected with a fluoroquinolone. Antimicrob Agents Chemother 2001;45:1467-72.
19Sato T, Yokota S, Uchida I, Okubo T, Usui M, Kusumoto M, et al. Fluoroquinolone resistance mechanisms in an Escherichia coli isolate, HUE1, without quinolone resistance-determining region mutations. Front Microbiol 2013;4:125.
20Ernst ME, Ernst EJ, Klepser ME. Levofloxacin and trovafloxacin: The next generation of fluoroquinolones? Am J Health Syst Pharm 1997;54:2569-84.
21Davis R, Bryson HM. Levofloxacin. A review of its antibacterial activity, pharmacokinetics and therapeutic efficacy. Drugs 1994;47:677-700.