Indian Journal of Medical Microbiology Home 

BRIEF COMMUNICATION
[Download PDF]
Year : 2017  |  Volume : 35  |  Issue : 1  |  Page : 113--115

Multiplex polymerase chain reaction for the detection of high-risk-human papillomavirus types in formalin-fixed paraffin-embedded cervical tissues

Mini P Singh1, Nalini Gupta2, T Deepak1, Archit Kumar1, Radha Kanta Ratho1,  
1 Department of Virology, Postgraduate Institute of Medical Education and Research, Chandigarh, India
2 Department of Cytology and Gynaecological Pathology, Postgraduate Institute of Medical Education and Research, Chandigarh, India

Correspondence Address:
Mini P Singh
Department of Virology, Postgraduate Institute of Medical Education and Research, Chandigarh - 160 012
India

Abstract

Detecting high-risk-human papillomavirus (HPV) types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR) for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.

How to cite this article:
Singh MP, Gupta N, Deepak T, Kumar A, Ratho RK. Multiplex polymerase chain reaction for the detection of high-risk-human papillomavirus types in formalin-fixed paraffin-embedded cervical tissues.Indian J Med Microbiol 2017;35:113-115

How to cite this URL:
Singh MP, Gupta N, Deepak T, Kumar A, Ratho RK. Multiplex polymerase chain reaction for the detection of high-risk-human papillomavirus types in formalin-fixed paraffin-embedded cervical tissues. Indian J Med Microbiol [serial online] 2017 [cited 2020 Sep 20 ];35:113-115
Available from: http://www.ijmm.org/text.asp?2017/35/1/113/202322

Full Text



 Introduction



Human papillomavirus (HPV) belongs to the family Papillomaviridae and plays a critical role in the development of cervical cancer. High-risk-HPV (HR-HPV types 16 and 18) has been associated with cervical cancer in about 80% of the cases.[1] Cervical cancer progresses from the stages of cervical intraepithelial neoplasia (CIN) Grades 1, 2 and 3 before the development of cancer. The main aim of the cervical screening programmes is early detection of precancerous lesions for timely intervention. The detection of HR-HPV types is objective, reproducible and also less demanding in terms of training and quality assurance. However, the detection of DNA from formalin-fixed and paraffin-embedded (FFPE) tissues is a challenge owing to DNA fragmentation, DNA cross-linking and presence of polymerase chain reaction (PCR) inhibitors. Hence, it is pertinent to check for the efficiency of DNA extraction using a housekeeping gene. In this regard, the present work was aimed at developing a multiplex PCR for the detection of HPV types 16 and 18 and the housekeeping gene in the same run so as to decrease the cost and the time required for identification of these types. This was used to test for the presence of these HPV types in FFPE samples.

 Materials and Methods



Samples

The study included 59 randomly selected FFPE tissue blocks of cervical biopsy specimens from the archives of the department of cytology and gynaecological pathology. These were the specimens received from women with suspicious cervical lesions. The histopathological findings were recorded by an experienced pathologist. The study was cleared by the Institute's Ethics Committee as per the national guidelines.

DNA extraction

Three 15 µm paraffin sections were cut from each FFPE specimen and deparaffinised using xylene and ethanol in reducing concentrations. The blades were cleaned with xylene and ethanol to avoid cross-contamination between sections cutting in consecutive tissue blocks. The DNA was extracted using commercially available kit (Qiagen, Stockach Germany), and the integrity and purity were assessed spectrophotometrically.

Multiplex polymerase chain reaction

Multiplex PCR was carried out using the following set of primers targeting the upstream regulatory region of HPV 16 (271 bp), E6 region of HPV 18 (100 bp) and beta globin gene (268 bp).[2]

HPV 16:

Forward: AAGGCCAACTAAATGTCACReverse: CTGCTTTTATACAACCGG

HPV 18:

Forward: ACCTTAATGAAAAACCACGAReverse: CGTCGTTTAGAGTCGTTCCTG

Beta globin:

Forward: GAAGAGCCAAGGACAGGTACReverse: CAACTTCATCCACGTTACACC.

Three microlitres of eluted DNA was used for amplification with 1X PCR buffer (10 mM Tris with 15 mM MgCl2), 200 µM of dNTPs (Fermentas, MD, USA), 1 µM of each forward and reverse primer and 1 unit of Taq polymerase (Genei, Bangalore, India). The reaction condition was standardised to initial denaturation at 94°C for 5 min, followed by 30 cycles with 94°C for 30 s, 55°C for 30 s, 72°C for 1 min and final extension at 72°C for 5 min using Eppendorf Thermocycler (Eppendorf, Hamburg Germany). The bands were visualised in 3% agarose gel (Sigma, Bengaluru, India) stained with ethidium bromide. The positive control Master Mix consisted of spiked clones of HPV types 16 and 18 (received as a gift from Dr. EM Villiers, DKFZ Institute, Germany) along with DNA extracted from human epithelioma cell line (Hep-2) [Figure 1].{Figure 1}

Statistical analysis

Fisher's exact test was used for statistical analysis, and P < 0.05 was considered statistically significant.

 Results



A total of 59 cervical biopsy samples were included, however only 55 were further analysed due to absence of beta globin amplification in four samples. Histopathologically, they were categorized into cervical cancer which included squamous cell carcinoma (SCC; n = 32), adenocarcinoma (ADC: n = 6) and cervical dysplasia (CIN 1: n = 4, CIN 3: n = 13). Overall, 19 (50%) samples from patients with cancer were positive for HR-HPV types versus 9 (52.9%) in CIN lesions [Table 1]. The staging was done only for 38 carcinoma cases and was as follows: 32 cases of SCC were classified as Stage IIA-1, Stage IIB-5, Stage IIIA-15, Stage IIIB-6, Stage IV-3, stage not known-2, and six cases of ADC were classified as stage IIA-3, Stage IIIA-1 and stage not known-2. No significant difference was observed in HPV 16 positivity between cervical cancer cases and cervical dysplasia cases (P = 1.0). Similarly, no statistical significant difference was observed in HPV 16 positivity from cases of age <40 years (8/10) and more than 40 years (20/45; P = 0.07). HPV 18 could not be detected in any of the samples tested.{Table 1}

 Discussion



Over the years, the FFPE samples have been increasingly used for the diagnosis of various infections including HPV. In the present study, HPV types 16 and 18 were detected in the FFPE samples by a multiplex PCR reaction, wherein an overall 50.9% positivity of HPV 16 was observed in patients with cervical lesions and cancer. A worldwide study [3] carried out on FFPE samples has reported HPV 16 positivity of 60% in Asia which is similar to our positivity. Though there are many studies from India which have carried out HR-HPV detection in cervical biopsy samples, the studies on FFPE samples are scarce. A study from South India [4] has reported an overall HPV 16 positivity of 65.2% in thirty FFPE samples tested from patients with cervical cancer and CIN. Two other studies from central and western India have documented a high HPV 16 positivity of about 82% in cases with SCC [4] and 76.1%[5] in all cervical carcinomas. The low positivity of HPV 16 and the absence of HPV 18 in this study can be attributed to the low prevalence of HPV infection in our region as shown by a recent study from our group which has found 30.1% and 6.95% positivity to HPV 16 and 18, respectively, in liquid-based cervical cytology samples [6] and also due to the low sample size of the present study.

The identification of HR-HPV types in CIN lesions is important for making treatment decisions as per recent guidelines.[7] Indian studies have reported HPV 16 in 32.8%–76.4% and HPV 18 in 2.4%–16.3% of CIN cases.[5],[8] Out of 17 CIN cases in our study, HPV 16 positivity was 52.9%. As there is a wide difference in the HR-HPV positivity in CIN specimens, HPV 16 and 18 testing only cannot be relied as a sole screening test for cervical cancer prevention programmes. The ideal approach would be to include the L1 region consensus primers also in the multiplex PCR protocol so as to identify other HR-HPV types. However, we failed to amplify the L1 region probably due to the DNA fragmentation that occurred due to the long-term storage of these samples in formalin as shown in a previous study.[9] The advantage of our PCR method is that it detects the HPV 16, HPV 18 and the beta globin gene in a single run. Although various real-time-based assays have been developed, utilising conventional multiplex PCR is cost effective, helps in the diagnosis of major HR-HPV types (16 and 18) which cause cancer cervix in India and can be carried out in resource-limited settings. Hence, it is an ideal method for cervical cancer screening programmes meant for large populations because it can detect the two most common HR-HPV types along with the adequacy of sample collection.

 Conclusion



The multiplex PCR, for detection of HR-HPV types, may be useful in resource limited settings in cervical cancer screening programmes.

Acknowledgement

The authors are thankful to Mr. Jasmine Khurana, laboratory technician, Department of Virology, for his help in sample processing.

Financial support and sponsorship

This study was funded by the institute as a part of intramural research project for the year (2012-13).

Conflicts of interest

There are no conflicts of interest.

References

1Pillai RM, Babu JM, Jissa VT, Lakshmi S, Chiplunkar SV, Patkar M, et al. Region-wise distribution of high-risk human papillomavirus types in squamous cell carcinomas of the cervix in India. Int J Gynecol Cancer 2010;20:1046-51.
2Shukla S, Bharti AC, Mahata S, Hussain S, Hedau S, Sharma R, et al. Application of a multiplex PCR to cervical cells collected by a paper smear for the simultaneous detection of all mucosal human papillomaviruses (HPVs) and typing of high-risk HPV types 16 and 18. J Med Microbiol 2010;59:1303-10.
3de Sanjose S, Quint WG, Alemany L, Geraets DT, Klaustermeier JE, Lloveras B, et al. Human papillomavirus genotype attribution in invasive cervical cancer: A retrospective cross-sectional worldwide study. Lancet Oncol 2010;11:1048-56.
4Gheit T, Vaccarella S, Schmitt M, Pawlita M, Franceschi S, Sankaranarayanan R, et al. Prevalence of human papillomavirus types in cervical and oral cancers in central India. Vaccine 2009;27:636-9.
5Deodhar K, Gheit T, Vaccarella S, Romao CC, Tenet V, Nene BM, et al. Prevalence of human papillomavirus types in cervical lesions from women in rural Western India. J Med Virol 2012;84:1054-60.
6Bhar VS, Gupta N, Singh MP, Nijhawan R, Srinivasan R, Suri V, et al. Human papillomavirus (HPV) types 16 and 18 in liquid-based cervical cytology samples. Virchows Arch 2015;466:711-5.
7World Health Organisation. WHO Guidelines for Screening and Treatment of Precancerous Lesions for Cervical Cancer Prevention. Available from: http://www.apps.who.int/iris/bitstream/10665/94830/1/9789241548694_eng.pdf. [Last accessed on 2017 Feb 14].
8Bhatla N, Dar L, Rajkumar Patro A, Kumar P, Pati SK, Kriplani A, et al. Human papillomavirus-type distribution in women with and without cervical neoplasia in North India. Int J Gynecol Pathol 2008;27:426-30.
9Alvarez-Aldana A, Martínez JW, Sepúlveda-Arias JC. Comparison of five protocols to extract DNA from paraffin-embedded tissues for the detection of human papillomavirus. Pathol Res Pract 2015;211:150-5.