Indian Journal of Medical Microbiology Home 

ORIGINAL ARTICLE
[Download PDF]
Year : 2015  |  Volume : 33  |  Issue : 5  |  Page : 15--19

Comparison of conventional, immunological and molecular techniques for the diagnosis of symptomatic congenital human cytomegalovirus infection in neonates and infants

A Choudhary1, SK Pati2, RK Patro3, AK Deorari4, L Dar1,  
1 Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India
2 Department of Pediatrics, UAB School of Medicine, Birmingham, Alabama, USA
3 Department of Microbiology, All India Institute of Medical Sciences, Bhubaneswar, Odisha, India
4 Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, India

Correspondence Address:
L Dar
Department of Microbiology, All India Institute of Medical Sciences, New Delhi
India

Abstract

Purpose: Human cytomegalovirus (HCMV) is the commonest pathogen causing congenital infection globally. The diagnosis of congenital infection is based either on viral isolation (in cell culture) or demonstration of HCMV DNA from the urine. Saliva is also being used as an alternative sample to urine for the same. The objective of this study was to compare the following assays-polymerase chain reaction (PCR) from urine, saliva and blood, serology (anti-HCMV IgM) and antigen detection (HCMV pp65 antigenaemia) for the diagnosis of congenital HCMV infection. Materials and Methods: Urine and blood samples were collected from 31 infants (median age: 13 weeks) with suspected HCMV infection. For 18 infants, additional saliva samples were collected and all the above assays were compared. Results: PCR for HCMV DNA from urine and anti-HCMV IgM were performed for all 31 infants. Of these, 22 (70.9%) were positive for both assays. In 18 (of the 22) infants positive by both assays, PCR for HCMV DNA from saliva was positive in all 18 (100%), PCR from blood in 7/18 (38.8%) and HCMV pp65 antigenaemia only in 1/18 (5.5%) of the infants. Conclusion: Detection of HCMV DNA in urine combined with anti-HCMV IgM are suitable assays to diagnose HCMV infection in infants. Both PCR from the blood and HCMV pp65 antigenaemia lack sensitivity in infants. Salivary PCR combines convenience with high sensitivity and can substitute PCR from urine, especially in the outpatient and field settings. To the best of our knowledge, this is the first study from India to evaluate salivary PCR for the diagnosis of congenital HCMV infection.

How to cite this article:
Choudhary A, Pati S K, Patro R K, Deorari A K, Dar L. Comparison of conventional, immunological and molecular techniques for the diagnosis of symptomatic congenital human cytomegalovirus infection in neonates and infants.Indian J Med Microbiol 2015;33:15-19

How to cite this URL:
Choudhary A, Pati S K, Patro R K, Deorari A K, Dar L. Comparison of conventional, immunological and molecular techniques for the diagnosis of symptomatic congenital human cytomegalovirus infection in neonates and infants. Indian J Med Microbiol [serial online] 2015 [cited 2019 Nov 22 ];33:15-19
Available from: http://www.ijmm.org/text.asp?2015/33/5/15/150874

Full Text

 Introduction



Human cytomegalovirus (HCMV), a ubiquitous human-specific DNA virus of the herpesviridae family, is the commonest agent causing congenital infection in humans throughout the globe. [1],[2] The seroprevalence of infection with HCMV varies in the developed and developing countries with racial, ethnic, cultural and socioeconomic factors all contributing to these differences. In the developed world, the seroprevalence of the virus in the general population is between 50-70%, [3],[4] the corresponding figure for the developing nations ranging from 70-100%. In India, this figure approaches 98-100%. [5] The rates of congenital infection in developed countries are about 0.6-0.7% of live births, whereas in the developing world, higher rates between 1-5% have been observed. [1],[3] Congenital HCMV infection is asymptomatic in more than 90% of infected infants, whereas the remaining 10% show manifestations including microcephaly, small for gestational age (SGA), neonatal hepatitis, hepatomegaly, splenomegaly, chorioretinitis, cataract, thrombocytopenia, etc, Some of these symptomatic infants also develop sensorineural hearing loss (SNHL) in the ensuing few years. [2] A fraction of infants who were asymptomatic at birth also go on to develop complications like SNHL and neurodevelopmental delays in the next few years of their lives. In fact, it is now established that congenital HCMV infection is the leading cause of nonsyndromic SNHL in the developed world. [2]

The diagnosis of congenital HCMV infection has traditionally been based on demonstration of the virus in urine by isolation in cell culture. Owing to the slow turn-around time for cell culture and its low sensitivity, demonstration of HCMV DNA in urine by PCR has gradually replaced virus isolation. [2] Demonstration of IgM antibodies to HCMV (anti-HCMV IgM) is a common diagnostic test in neonates or infants, which suggests current infection and supports the diagnosis. Other tests, utilising blood as a sample, include demonstration of HCMV DNA by PCR and detection of HCMV pp65 antigen. Besides urine, saliva has been used as a sample for demonstration of HCMV DNA by PCR with results comparable to those obtained from urine. [6],[7]

The aim of this study was to compare PCR from urine, saliva and blood, serology (anti-HCMV IgM) and antigen detection (HCMV pp65 antigenaemia) for the diagnosis of HCMV infection in symptomatic neonates and infants. Since saliva is a convenient sample to collect and process, and no reports are available from India regarding its utility for PCR, we wanted to evaluate it in comparison with other samples like urine and blood. As detection of anti-HCMV IgM is a commonly used test for the diagnosis of congenital HCMV infection, we also compared this modality with PCR. There are only a few reports for the use of pp65 antigenaemia in the diagnosis of congenital infections, [8] even though it is an established test for diagnosing active HCMV infection in adults, especially in transplant recipients.

 Materials and Methods



The study was carried out in the virology laboratory of the department of Microbiology, All India Institute of Medical Sciences (AIIMS), New Delhi between July 2005 and July 2007. Neonates and infants with suspected HCMV infection, referred from the neonatology unit, the outpatients department or wards of the department of Paediatrics, were included in the study. The inclusion criteria were any one or more of the following: neonatal hepatitis, SGA (birth weight <10 th percentile for the period of gestation), microcephaly, hydrocephalus, hepatomegaly, splenomegaly, petechial/purpuric rash, cataract, chorioretinitis and corneal opacity. Exclusion criteria included sepsis, inherited primary microcephaly, hepatomegaly and/or splenomegaly due to inborn errors of metabolism, and SGA due to antenatal causes. The study was approved by the ethics committee of the institute. Informed written consent was obtained from the mothers of all infants included in the study. [Table 1] enlists the assays performed in the study.{Table 1}

The steps involved in sample collection, transport and processing are described briefly: For urine, about 5-10 ml of freshly voided, clean catch midstream urine was collected in a sterile 15 ml screw-capped tube and transported to the laboratory immediately. The sample was treated with antibiotics (Penicillin 100 IU/ml and Streptomycin 100 μg/ml) and kept at 4°C overnight. The next day, it was clarified by centrifugation and the supernatant was used for PCR. The remaining sample was stored at −80°C. Saliva was collected by rubbing a plain cotton-tipped sterile swab across the buccal mucosa over the molars in the proximity of the Stenson's duct and then over the floor of the mouth anterior to the tongue. The swab was subsequently immersed in 1.5 ml of 2-sucrose phosphate Viral Transport Media (VTM) and transported to the laboratory immediately. There, the tip of the swab was pressed thoroughly against the side of the tube in order to express out all the saliva into the medium and then discarded appropriately. The VTM containing the saliva was then centrifuged at 1,000 rpm for 10 min. at 4°C, and the supernatant used for PCR. The remaining sample was stored at −80°C. A total of about 3 ml blood was collected aseptically by peripheral venepuncture, 2 ml of which was collected in an ethylenediaminetetraacetic acid (EDTA) vaccutainer (Becton Dickinson, USA), and the remaining 1 ml in a plain sterile vial. The EDTA-treated blood was used for HCMV pp65 antigenaemia assay and for PCR. The blood collected in the plain vial was left undisturbed for an hour, allowing the blood to clot, following which the clot was carefully removed and the serum separated for the anti-HCMV IgM assay.

DNA was extracted from urine and saliva using a commercially available kit (QIAamp Viral RNA Minikit, Qiagen Inc, CA, USA). Amplification of HCMV DNA was performed by an in-house standardised nested PCR for the gB gene, using published primers. [9] The external primers were gB1138 5′ CAAGARGTGAACATGTCCGA 3′ and gB1638 3′ GTCACGCAGCTGGCCAG 5′ which allowed the amplification of a 501bp sequence; the inner primers were gB1276 5′GGTTTGGTGGTGTTCTGGCA3′ and gB1524 3′CACACACCAGGCTTCTGCGA5′ which allowed the amplification of a 249 bp sequence from the gB gene, following a published protocol. [10] The amplified products were run on agarose gel and visualised on a ultraviolet (UV) transilluminator after ethidium bromide staining [Figure 1]. A standard strain of HCMV (AD 169) was used as the positive control.{Figure 1}

The anti-HCMV IgM (μ-capture) enzyme-linked immunosorbent assay (ELISA) was performed using a commercial kit (CMV IgM Capture Smart Test Diagnostics, Orgenics Ltd, Israel) following manufacturer instructions. The HCMV pp65 antigenaemia assay [Figure 2] was performed using a commercially available kit (CMV Brite Turbo, Biotest Diagnostic Corp. Denville, NJ, USA) following manufacturer instructions.{Figure 2}

 Results



Thirty-one neonates and infants with suspected congenital infection, who fulfilled the inclusion and exclusion criteria were included in the study. Twenty-two (71%) of these infants were male and the remaining 9 (29%) were female. The median age at presentation was 13 weeks (range: 1 day to 10 months). Initially, PCR for HCMV DNA from urine and detection of anti-HCMV IgM were performed, and the results of these two assays shown in [Table 2].{Table 2}

Twenty-two (70.9%) infants were positive by both tests, while 5 (16.1%) were negative by both tests, giving a concordance of 86.7% between the two tests. Three infants of the 31 (9.7%) were positive for anti-HCMV IgM but negative for HCMV DNA, whereas 1 infant (3.2%) was negative for anti-HCMV IgM but positive for HCMV DNA.

Of the 22 infants who were positive for both HCMV IgM and urine PCR, salivary swabs could be collected in 18. A detailed history with findings of physical examination and other radiological investigations were recorded for the latter. HCMV DNA was detected in the saliva of all 18 (100%) infants. However, HCMV DNA was detectable in the whole blood of only 7 (38.8%) of these 18 infants, while the pp65 antigenaemia assay was positive in only 1 neonate (5.5%) who was born premature.

The clinical and laboratory data of the 18 infants positive for both HCMV DNA in urine by PCR and anti-HCMV IgM are given in [Table 3]. {Table 3}Hepatosplenomegaly was the commonest clinical manifestation in 16 (88.9%), whereas  direct (conjugated) hyperbilirubinaemia was observed in 11 (61.1%), with clinically apparent icterus in 9 (50%) infants.

 Discussion



In this study, we intended to compare the various modalities utilised in the diagnosis of congenital HCMV infection in neonates and infants. The commonest samples received in the virology laboratory are serum (for anti-HCMV IgM) and urine (for HCMV DNA by PCR). Further, we evaluated the usefulness of saliva and blood for detection of HCMV DNA by PCR, and also of HCMV pp65 antigenaemia by immunofluorescence as an antigen detection assay in this scenario.

[Table 2] has compared the results of IgM (μ-capture) ELISA with urine PCR for the 31 infants included in the study. Twenty-two infants (70.9%) had both the tests positive. Hence, in 25 (80.6%) infants with suspected congenital HCMV infection, the anti-HCMV IgM assay was able to pick up evidence of infection in them. On the other hand, PCR for HCMV DNA from urine was positive in 23 of 31 (74.2%) of these cases. The slight lower positivity of PCR can be explained by the intermittent excretion of the virus from the kidneys in congenital HCMV infection. Earlier studies [11],[12] have also demonstrated that although PCR is highly specific, anti-HCMV IgM is more convenient and has a higher or similar sensitivity to PCR, particularly in infants who present to the hospital late after birth. In our study, the median age of presentation was 13 weeks. One infant had a negative Anti-HCMV IgM but urine PCR was positive for HCMV DNA. The age at presentation for this baby was 10 months and his clinical profile revealed hepatosplenomegaly since birth. The negative IgM ELISA can be explained by the disappearance of anti-HCMV IgM by this age. Anti-HCMV IgM is known to sharply drop in titre in 2-3 months after onset of infection and are virtually undetectable within 12 months. [13] The PCR was reconfirmed by testing another target gene (gN) of HCMV, indicating that it was a true positive result.

The results of saliva PCR and urine PCR were  totally concordant for the 18 neonates that these tests were performed on. Each of the 18 neonates/infants whose urine PCRs were positive for HCMV DNA also had their saliva PCR positive for the same. This supports the results of earlier studies and shows that saliva is as reliable as urine for detection of HCMV infection in neonates and infants. [6] Another study from Brazil also revealed a 99.7% agreement between the results of both the samples. Further, the authors recommended the use of saliva for detection of HCMV DNA via PCR as an acceptable technique for large-scale detection of congenital HCMV infection (e.g. neonatal screening programmes). [7],[14]

In a previous study [15] that looked at various diagnostic modalities, the sensitivities of HCMV DNAemia (by PCR), antigenaemia and anti-HCMV IgM were 100%, 42.5% and 70.7% respectively, while specificity was 100% for all assays. This study concluded that determination of viral DNA in blood by PCR at birth appears to be as sensitive and specific as virus recovery from urine. A previous study from Italy [16] detected HCMV pp65 antigen in 10 (29.4%) of 34 newborn infants. However, in our study, PCR for HCMV DNA from blood was positive in only 7 (38.3%), while the assay for HCMV pp65 antigenaemia was positive in only 1 (5.6%) of the 18 infants. It should be noted that the babies in both these studies [15],[16] were tested at a much earlier age compared to those in our study. Except for one premature neonate who could be tested on day 1 of life, we could not perform this assay in the initial few weeks of birth, since the median age of presentation of our cohort was 13 weeks. The sensitivity of HCMV pp65 antigenaemia assay has been reported to be low except in premature neonates, especially if tested within the few days of birth. [16] The lower positivity of whole blood PCR can be explained by the fact that viraemia does not persist beyond a few days of birth, after which the virus is localised in the epithelia of the kidney and salivary glands and is shed (and thence detected) mainly in the urine and saliva. [2]

 Conclusion



study concludes that either urinary or salivary PCR combined with anti-HCMV IgM are the most appropriate assays to detect congenital HCMV infection in our setting. Saliva is a convenient, noninvasive sample and can substitute urine, especially in the outpatient and field settings. Saliva as a sample combines convenience with high sensitivity in the diagnosis of congenital HCMV infection. To the best of our knowledge, this is the first study evaluating salivary PCR for the diagnosis of congenital HCMV infection from the country.

References

1Manicklal S, Emery VC, Lazzarotto T, Boppana SB, Gupta RK. The 'silent' global burden of congenital cytomegalovirus. Clin Microbiol Rev 2013;26:86-102.
2Mocarski ES, Shenk T, Griffiths PD, Pass RF. Cytomegaloviruses. In: Knipe DM, Howley PM, editors. Fields Virology. 6 th ed., Vol. 2. Wolters Kluwer Health. Philadelphia: Lippincott Williams and Wilkins; 2003. p. 1960-2014.
3Cannon MJ. Congenital cytomegalovirus (CMV) epidemiology and awareness. J Clin Virol 2009;46 Suppl 4:S6-10.
4Stagno S, Dworsky ME, Torres J, Mesa T, Hirsh T. Prevalence and importance of congenital cytomegalovirus in three different populations. J Pediatr 1989;101:897-900.
5Dar L, Pati SK, Patro AR, Deorari AK, Rai S, Kant S, et al. Congenital cytomegalovirus infection in a highly seropositive semi-urban population in India. Pediatr Infect Dis J 2008;27:841-3.
6Warren WP, Balcareck K, Smith R, Pass RF. Comparison of rapid methods of detection of CMV in saliva with virus isolation in tissue culture. J Clin Microbiol 1992;30:786-9.
7Boppana SB, Ross SA, Shimamura M, Palmer AL, Ahmed A, Michaels MG, et al. National Institute on Deafness and Other Communication Disorders CHIMES Study. Saliva polymerase chain reaction assay for cytomegalovirus screening in newborns. N Eng J Med 2011;364:2111-8.
8Barbi M, Binda S, Primache V, Novelli C. Cytomegalovirus in peripheral blood leukocytes of infants with congenital or postnatal infection. Pediatr Infect Dis J 1996;15:898-903.
9Binder T, Siegert W, Kruse A, Oettle H, Wilborn F, Peng R, et al. Identification of HCMV variants by analysis of single stranded conformation polymorphism and DNA sequence of the envelope gB gene region-distribution frequency in liver transplant recipients. J Virol Methods 1999;78:153-62.
10Chou SW, Dennison KM. Analysis of interstrain variation in CMV group B sequence encoding neutralization related epitopes. J Infect Dis 1991;163:1229-34.
11Gandhoke I, Aggarwal R, Hussain SA, Pasha ST, Sethi P, Thakur S, et al. Congenital CMV infection: Diagnosis in symptomatic infants. Indian J Med Microbiol 2009;27:222-5.
12Sivakumar R, Singh N, Singh S. Nested PCR in the diagnosis of congenital HCMV infection. Indian J Pediatr 2001;68:1043-6.
13Revello MG, Gerna G. Diagnosis and management of human cytomegalovirus infection in the mother, fetus and newborn infant. Clin Microbiol Rev 2002;15:680-715.
14Yamamoto AY, Mussi-Pinhata MM, Marin LJ, Brito RM, Oliveira PF, Coelho TB. Is saliva as reliable as urine for detection of cytomegalovirus DNA for neonatal screening of congenital CMV infection? J Clin Virol 2006;36:228-30.
15Revello MG, Zavattoni M, Furione M, Baldanti F, Gerna G. Quantification of human cytomegalovirus DNA in amniotic fluid of mothers of congenitally infected fetuses. J Clin Microbiol 1999;37:3350-2.
16Lanari M, Lazzarotto T, Venturi V, Papa I, Gabrielli L, Guerra B, et al. Neonatal cytomegalovirus blood load and risk of sequelae in symptomatic and asymptomatic congenitally infected newborns. Pediatrics 2006;117:e76-83.