Indian Journal of Medical Microbiology Home 

ORIGINAL ARTICLE
[Download PDF]
Year : 2013  |  Volume : 31  |  Issue : 2  |  Page : 123--129

Over-expression of gene encoding heat shock protein 70 from Mycobacterium tuberculosis and its evaluation as vaccine adjuvant

J Dhakal1, GS Brah1, RK Agrawal2, HN Pawar1, D Kaur1, R Verma1,  
1 Department of Microbiology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, India
2 School of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, India

Correspondence Address:
R K Agrawal
School of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab
India

Abstract

Background: Heat shock proteins (Hsps) are evolutionary ancient and highly conserved molecular chaperons found in prokaryotes as well as eukaryotes. Hsp70 is a predominant member of Hsp family. Microbial Hsp70s (mHsp70s) have acquired special significance in immunity since they have been shown to be potent activators of the innate immune system and generate specific immune responses against tumours and infectious agents. Objectives: The present study was aimed to clone express and purify recombinant Hsp70 from the Mycobacterium tuberculosis and characterise it immunologically. The study also aimed at determining the potential of recombinant M. tuberculosis heat shock protein (rMTB-Hsp70) as adjuvant or antigen carrier. Materials and Methods: Cloning of M. tuberculosis heat shock protein (MTB-Hsp70) amplicon was carried out using the pGEMT-Easy vector although for expression, pProExHTb prokaryotic expression vector was used. Purification of recombinant Hsp70 was carried out by nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography. For immunological characterization and determining the adjuvant effect of MTB-Hsp70, BALB/c mice were used. The data obtained was statistically analysed. Results: Hsp70 gene was cloned, sequenced and the sequence data were submitted to National Center for Biotechnology Information (NCBI). Recombinant MTB-Hsp70 was successfully over-expressed using the prokaryotic expression system and purified to homogeneity. The protein was found to be immunodominant. Significant adjuvant effect was produced by the rMTB-Hsp70 when inoculated with recombinant outer membrane protein 31; however, effect was less than the conventionally used the Freund«SQ»s adjuvant. Conclusion: Protocol standardised can be followed for bulk production of rHsp70 in a cost-effective manner. Significant adjuvant effect was produced by rMTB-Hsp70; however, the effect was than Freund«SQ»s adjuvant. Further, studies need to be carried out to explore its applicability as carrier of antigen.

How to cite this article:
Dhakal J, Brah G S, Agrawal R K, Pawar H N, Kaur D, Verma R. Over-expression of gene encoding heat shock protein 70 from Mycobacterium tuberculosis and its evaluation as vaccine adjuvant.Indian J Med Microbiol 2013;31:123-129

How to cite this URL:
Dhakal J, Brah G S, Agrawal R K, Pawar H N, Kaur D, Verma R. Over-expression of gene encoding heat shock protein 70 from Mycobacterium tuberculosis and its evaluation as vaccine adjuvant. Indian J Med Microbiol [serial online] 2013 [cited 2019 Oct 18 ];31:123-129
Available from: http://www.ijmm.org/text.asp?2013/31/2/123/115222

Full Text

 Introduction



The cells of all living organisms synthesize proteins known as heat shock proteins (Hsps). Hsps are a class of functionally related proteins whose expression is increased when cells are exposed to physiological perturbations or other stressors. [1] They act as molecular chaperones by participating in the assembly of proteins without being part of the final protein structure [2] and assist a large variety of protein folding processes in the cell by transient association of their substrate binding domain with short hydrophobic peptide segments within their substrate proteins.

Hsp70 is a predominant member of Hsp family, found in the cytosol and in other compartments of the cell. Immunological role of Hsps is of great concern as they serve as carriers of antigens and effectively induce antigen-specific B- and T-cell responses without the need of adjuvant help. [3],[4],[5],[6] The immunomodulatory functions of Hsps are based on various properties: (i) They stimulate the production of chemokines, which attract immunological cells; (ii) they possess the ability to activate dendritic cells thereby initiating the innate immune responses and (iii) they are capable of delivering peptides to major histocompatibility complex (MHC) molecules; thus, priming the adaptive immunity. [7] The antigen binding property of Hsp can be exploited as potent vaccine adjuvant in eliciting immune responses and as a powerful inducer of antitumour immunity. [8] The homogeneous preparations of certain Hsps isolated from cancer cells elicit immunity to cancers, whereas corresponding preparations from normal tissues do not. [9] The internalized Hsp-peptide complex is processed in the cytosol of antigen presenting cells, associated with MHC-I and MHC-II and presented to the CD8+T cells and CD4+T cells, respectively. [10],[11]

A major challenge in developing effective vaccine is to develop a vaccine with least side-effect and at the same time inducing powerful immune response to the desired antigen. Poor immunogenicity and MHC restriction hamper the potential of many candidate antigens. [12] Use of appropriate carrier and adjuvant molecules can improve the immunogenicity. Members of the Hsp70 family, specially microbial Hsp70 (mHsp70) have acquired special significance in immunity since they have been shown to be potent activators of the innate immune system and generate antigen specific immune responses against tumours and infectious agents. Hsps are highly immunogenic, functions as adjuvant and play a crucial role in linking innate and adaptive immunity. Many studies have described the ability of mHsp70 to enhance the immunogenicity of associated antigens. [4],[13],[14],[15]

In order to conduct studies for exploration of various functions of mHsp70, the primary requirement is to have enough quantity of highly purified protein. Therefore, the present study was aimed to clone, express, and purify recombinant Hsp70 from Mycobacterium tuberculosis and to characterise it immunologically. The study also aimed to evaluate the potential of recombinant M. tuberculosis heat shock protein 70 (rMTB-Hsp70) as vaccine adjuvant using the recombinant outer membrane protein 31 (rOmp31) of Brucella abortus as subunit vaccine candidate.

 Materials and Methods



Bacterial strains and plasmids

M. tuberculosis standard strain was procured and cultured on Lowenstein-Jensen medium. Cloning vector pGEMT-Easy (Promega, USA) was used for cloning and prokaryotic expression vector pProExHTb (Invitrogen, USA) for expression. Escherichia coli (DH5α) were used as host for cloning and expression. Ampicillin was added in the medium to a final concentration of 100 μg/ml whenever required. Bacteriological media and supplements were procured from HiMedia, Mumbai, India and prepared as per the manufacturer's recommendations. Molecular biology grade chemicals were procured from SRL, Mumbai, India until unless specified. Polymerase chain reaction (PCR) reagents and conjugates were procured from Merck-Genei, India. Restriction enzymes were procured form Fermentas, USA. For animal experiments, BALB/c mice were used. The permission for animal experiments was granted by the Institutional Animal Ethics Committee (No. VMC/2010/IAEC/1976-92 Dated 17-12-2010).

DNA isolation

Cetyltrimethyl ammonium bromide method of DNA extraction was used for chromosomal DNA isolation from M. tuberculosis. [16] Concentration and purity of DNA was assessed by UV spectrophotometry using the Nanodrop system (ND 1000, Thermo Scientific, USA).

PCR of Hsp70

For PCR amplification, primers were designed covering entire orf after clustal analysis (Clustalw) of the Hsp70 gene sequences for genus Mycobacterium available on NCBI database. Restriction endonuclease sites for NcoI and XhoI were included in the forward and reverse primers respectively (underlined and italicized). Three base pairs (cgc) were added to the extreme 5′ end of the forward and reverse primers for proper binding of the restriction enzymes at their recognition sites. Two additional base pairs (cc; shown in bold) were included in the forward primer to maintain the reading frame in the selected prokaryotic expression vector (pProExHT). The sequence of the primers designed is M. tuberculosis heat shock protein (MTB-Hsp70) F: 5′ cgcccatggccatggctcgtgcggtcgggatc 3′ and MTB-Hp70 R: 5′ cgcctcgagtcacttggcctcccggccgtc 3′. The primers were custom synthesised from Integrated DNA Technologies, USA. The PCR assay was optimized in 25 μl reaction mixture. Standardised PCR reaction was containing 1 × PCR buffer, 2.5 mM MgCl 2 , 200 μM dNTP mix, 20 pM each of forward and reverse primers, 2.5U of Taq DNA polymerase, 5% DMSO and approximately, 100 ng of template DNA. Cycling conditions standardised for PCR were 1 cycle of initial denaturation at 95°C for 5 min followed by 35 cycles each of denaturation (95°C for 1 min), annealing (57°C for 1 min) and extension (72°C for 2 min) followed by final extension at 72°C for 10 min. The PCR product was analysed on 1.5% agarose gel and photographed on gel documentation system (Biorad, USA).

Cloning of Hsp70 and sequencing

For cloning, gel purified PCR product was ligated with the pGEMT-Easy TM vector as per standard protocol and ligated product was transformed in freshly prepared DH5α competent cell by heat shock method (42°C). Transformed cells were plated on Luria Bertani agar containing ampicillin (100 μg/ml), X-gal (20 μg/ml) and isopropyl β-D-thiogalactopyranoside (IPTG, 50 μg/ml) for blue-white screening. Clones were confirmed by PCR and restriction digestion. One positive clone was sequenced. The sequence data obtained was analysed and deduced Hsp70 orf was submitted to NCBI-GeneBank and accession number was obtained.

Expression and purification of recombinant Hsp70

For construction of recombinant expression plasmid, gel purified Hsp70 amplicon and pProExHTb prokaryotic expression vector were digested with NcoI and XhoI, re-purified and ligated in 20 μl reaction followed by transformation in DH5α competent cells. Plating was carried out on LB agar plates containing ampicillin. Clones were confirmed by PCR and restriction digestion. One positive clone was induced by adding IPTG (0.6 mM). After induction, 1.5 ml samples were collected at hourly interval up to 6 h to study expression kinetics. Un-induced sample was collected before adding IPTG and used as negative control. All the samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) along with the Prestained protein ladder (Fermentas, USA).

Recombinant Hsp70 (rHsp70) was purified under denaturing conditions by Ni-NTA affinity chromatography following standard protocol. Briefly, the induced bacterial pellet (50 ml) was re-suspended in 10 ml of buffer B (pH 8.0). Cells were lysed by sonication at an amplitude of 10.0 (10 cycles of 30 s pulse on/off) using the microtip (Misonix, USA). Sonicated cell lysate was centrifuged at 13,000 rpm for 40 min to remove cell debris. The supernatant was collected and mixed with 5.0 ml of Ni-NTA agarose (Qiagen, USA) and left on gyroshaker for 2 h. The mixture was passed through a column containing porous silica bed and washed with ample quantity of buffer C (pH 6.3). Finally, the protein was eluted in small fractions using the buffer E (pH 4.5). Collected protein fractions were confirmed by SDS-PAGE. Small sized contaminant proteins (if any) and salts (urea) were removed from purified protein by dialysis against 1 × phosphate buffer saline (PBS) using a dialysis tubing of 12 kDa cut-off value (HiMedia, Mumbai).

Western blotting was performed for confirmation of rHsp70 fusion protein by using the Ni-HRP conjugate following standard protocol (Qiagen, USA). For this, following separation on SDS-PAGE, protein was electro-blotted on PVDF membrane using dry blotting apparatus (I-Blot, Invitrogen, USA). Blocking was carried out for 1 h with 3% BSA (SRL, India) followed by washing three times with TBS-tween 20 (TBS-T). Ni-HRP conjugate was diluted in TBS-T buffer (1:1000) and blot was soaked in it for 1 h. After washing for three times with TBS-T buffer, membrane was soaked in staining solution (18 mg of 4-chloro-1-napthol in 6 ml of methanol mixed to 24 ml of 1 × Tris-saline and finally 60 μl of 30% H 2 O 2 added). Development of colour was observed and reaction was stopped by rinsing the membrane in distilled water.

Immunological characterization of recombinant Hsp70

Purified rHsp70 was inoculated in BALB/c mice for its immunological characterisation. Concentration of rHsp70 was measured by UV spectrophotometry (280nM) using the Nanodrop System (ND-1000, Thermo Electron, USA). A total of 50 μg rHsp70 (mixed with equal quantity of Freund's incomplete adjuvant [FIA]) was inoculated per mice. The inoculation schedule followed was 0, 7, 14, and 21 day. Blood was collected on 30 th day by puncturing the caudal vein and serum was separated out. Western blotting was performed following similar protocol as described above using the hyperimmune antisera generated against rHsp70 as primary antibody and anti-mouse immunoglobulin G-horseradish peroxidase (anti-mouse IgG-HRP, Merck-Genei, India) as conjugate. Staining solution used was containing diaminobenzidine (DAB) as chromogen and hydrogen peroxide as substrate. The blot was photographed on gel documentation system (Biorad, USA).

Evaluation of rMTB-Hsp70 as vaccine adjuvant

Adjuvanticity of the rMTB-Hsp70 was evaluated in BALB/c mice using the rOmp31 as subunit vaccine candidate. Male (BABL/c) mice weighing 25-35 g were housed in cages and fed with commercially available mice pellet feed and fresh clean drinking water ad libitum. A total of twenty mice (n = 20) were divided into four groups of five mice each. Subcutaneous route of inoculation was used. Group I was injected with 50 μg of recombinant Brucella Omp31 having proven immunogenicity. [17] The group II was injected with Omp31 along with rMTB-Hsp70 as adjuvant (50 μg each). Group III was injected with rOmp31 (50 μg) along with equal quantity of FIA. Group IV was inoculated with PBS (50 μl) and used as negative control. Inoculation schedule followed was 0, 7, 14 and 21 day. Blood was collected at 30 days post-inoculation and serum was separated out.

The comparison of adjuvanticity was carried out by indirect enzyme-linked immunosorbent assay (ELISA) following the standard protocol. Briefly, coating antigen (rOmp31) was diluted to a working concentration of 20 μg/ml in carbonate/bicarbonate buffer. 100 μl of diluted antigen was loaded to each well and incubated overnight at 4°C. Plate was washed 3 times with the PBS-Tween 20 (PBST) and 200 μl of blocking buffer was added to each well-followed by incubation for 1 h at 37°C. Plate was washed for three times with PBST. Primary antibodies (hyperimmune serum raised against rOmp31 alone, rOmp31+rMTB-Hsp70, and Omp31+FIA) were diluted 1:10 in blocking buffer and 100 μl from each test group was added to the wells in triplicates. A control panel was set up with B. abortus standard serum diluted 1:2 in blocking buffer as positive control. The plate was incubated at 37°C for 1 h. Plate was washed three times with PBST. Anti-mouse IgG-horseradish peroxidase (HRPO) was used as conjugate after 1:500 dilution in blocking buffer and 100 μl of the diluted antibody were dispensed into each well. Plate was incubated at 37°C for 1 h. Plate was washed thrice with PBST. A volume of 100 μl substrate solution (containing H 2 O 2 and o-phenylenediamine was added to each well. Plate was covered with a plate sealer and incubated in dark for 10 min at 37°C. The reaction was stopped by adding 100 μl of stop solution (1 M H 2 SO 4 ). Absorbance was measured at 492 nm using the ELISA reader (Tecan, USA).

 Results



PCR amplification, cloning and sequencing of MTB-Hsp70

The extracted genomic DNA showed concentration of 260 ng/μl although OD 260/280 was found in the range of 1.7-1.8 indicating the optimum purity. Amplification of Hsp70 gene by PCR resulted in single specific band of 1878 bp [Figure 1]. Transformation of ligated product (Hsp70 amplicon in pGEMT Easy) resulted in development of mostly white colonies. Plasmids extracted from white colonies resulted in release of specific size insert in restriction digestion [Figure 2] while, single band of desired size (1878 bp) was obtained in PCR. Sequencing data of one confirmed clone (MTB-Hsp70/1) was analysed and deduced Hsp70 orf sequence was submitted to NCBI (Jx 040477).{Figure 1}{Figure 2}

Expression, purification and immunological characterisation of recombinant MTB-Hsp70

Transformation of ligated product (Hsp70 amplicon in pProExHTb) in DH5α competent cells resulted in numerous white colonies. Confirmation of clones by restriction digestion resulted in release of specific size insert (1878 bp) although specific size amplicon of 1878 was obtained in PCR. Induction of positive clone (MTB-Hsp70Exp/2) by IPTG resulted in a thick band corresponding to 70 kDa of the protein ladder, as compared to un-induced control. Expression kinetics indicated that the optimum expression was at 6 h post-induction. Protein purification by Ni-NTA affinity chromatography resulted in a specific approximately 70 kDa band as detected by SDS-PAGE with the minor contaminants [Figure 3]. Salts and small sized contaminant proteins were removed from purified protein by dialysis against 1 × PBS. Western blotting of purified and dialysed His-tagged Hsp70 fusion protein using the Ni-HRP conjugate resulted in dark violet coloured band at a location corresponding to approximately 70 kDa in the pre-stained protein ladder [Figure 4]. Similar results were obtained with hyperimmune antisera raised against rHsp70 in BALB/c mice indicating that the protein is immunogenic [Figure 5].{Figure 3}{Figure 4}{Figure 5}

Evaluation of rMTB-Hsp70 as adjuvant

The differences in antibody titres in various treatment groups were evaluated by indirect ELSIA. The data were analysed statistically using the one-way analysis of variance [Table 1]. The mean absorbance significantly varied (P ≤ 0.05) among the groups. Group 1 (rOmp32 alone) had significantly lower antibody titre (P ≤ 0.05) as compared to both groups 2 (rOmp31 with rMTB-Hsp70) and 3 (rOmp31 with FIA). Further, group 3 had significantly higher antibody titre (P ≤ 0.05) as compared to group 2 [Figure 6].{Figure 6}{Table 1}

 Discussion



The need for more effective vaccines for cancer and infections caused by intracellular pathogens has spurred intense investigation of immunogens and immunization strategies that elicit effective cell mediated immune response. Some important factors impeding the vaccine development are the poor immunogenicity and MHC restriction of the immune responses to a number of antigens. Most vaccines require adjuvant to provoke protective immune responses; however, most adjuvants available currently cause powerful and unpleasant side-effects in humans; thus, only alum, a very weak adjuvant, is permitted for use in human vaccines. The use of novel vaccine adjuvant or carrier proteins, which are known to enhance the immunogenicity of the subunit antigens and provide T-cell help, can circumvent these problems. The potential of Hsps to function as adjuvant when fused to or co-delivered with protein antigens, make them an attractive option to replace conventional vaccine adjuvants. There is currently a great deal of interest in developing vaccines that generate powerful immune responses without the use of adjuvants. The antigen binding property of Hsps can be exploited as potent vaccine adjuvant in eliciting immune responses and as a powerful inducer of antitumour immunity. [8]

Cloning and expression of rHsp70 from M. tuberculosis has been reported earlier using a various prokaryotic expression systems. [12],[18] Recombinant Hsp of mycobacterial origin with a molecular weight 70 kDa in concentration 0.1 μg/ml has been reported to activate cytotoxic activity of mononuclear lymphocytes from peripheral blood of healthy donors against K-562 human erythroblastic leukaemia cells sensitive to natural killers. [19] Many studies have described the ability of mHsp70s to enhance the immunogenicity of associated antigens. [14] gp96 preparations isolated from cells infected with intracellular bacteria were found to induce cytotoxic T-lymphocyte responses and conferred protection. [20] Importantly, Hsp70 fusion proteins induced these immune responses without adjuvants. [21] Extremely, small quantities of Hsp70 bound peptide, around 120 pM, can generate a CTL response in vivo, whereas 2000-fold higher concentrations of free peptide was unable to do so. [22],[23] Recombinant Hsp70 was used as adjuvant and fused and co-delivered with various protein antigens as an attractive vaccine candidate. [24] The antigenic nature of mycobacterial Hsp60 and Hsp70 allows them to be used as adjuvant-free carrier molecules under certain circumstances. When mycobacterial Hsp60 and Hsp70 were chemically cross-linked to the synthetic peptide (NANP) 40 , an epitope from the Plasmodium falciparum major surface protein, anti-(NANP) 40 antibodies production elicited in squirrel monkeys and various strains of mice in the absence of an adjuvant. [15],[25],[26] The mycobacterial Hsp70 moiety was found to increase dramatically the immunogenicity of the HIV-I gag p24 antigen in the absence of adjuvant. In contrast, mice immunised with the p24-OVA fusion protein failed to elicit high levels of anti p24 immune responses. [5] A series of experiments showed that the combination of adjuvant as cholera toxin and Hsp70 promoted efficient immune responses in the low responder C57BL/6 mice, generating antibodies of similar or higher affinity than those induced in the high responder CBA strain. [24],[27],[28],[29]

Preliminary requirement for using the Hsp70 as adjuvant or antigen carrier is its availability in purified form. The study shows that expression vector pPROExHTb and the protocol standardized can be followed for bulk production of rMTB-Hsp70 in a cost-effective manner. Experiments conducted in BALB/c mice indicate that rMTB-Hp70 is immunogenic in nature. Study shows that the rMTB-Hsp70 modulated the humoral immune response and acted as an adjuvant; however, effect produced was less than the conventionally used Freund's adjuvant. This might be due to the amount of rMTB-Hsp70 used as adjuvant (50 μg). Initial results are encouraging and experiments need to be planned in more comprehensive manner to further explore applicability of mHsp70 as vaccine adjuvant. Furthermore, role of mHsp70 in activating cell mediated branch of immune system need to be studied.

 Acknowledgment



The authors are grateful to the Director of Research cum Dean, PGS, and Director, School of Animal Biotechnology GADVASU, Ludhiana - 141 004 (Punjab) for providing funds and necessary infrastructural facilities to carry out the present study.

References

1De Maio A. Heat shock proteins: Facts, thoughts, and dreams. Shock 1999;11:1-12.
2Ellis J. Proteins as molecular chaperones. Nature 1987;328:378-9.
3Rico AI, Angel SO, Alonso C, Requena JM. Immunostimulatory properties of the Leishmania infantum heat shock proteins HSP70 and HSP83. Mol Immunol 1999;36:1131-9.
4Román E, Moreno C. Synthetic peptides non-covalently bound to bacterial hsp70 elicit peptide-specific T-cell responses in vivo. Immunology 1996;88:487-92.
5Suzue K, Young RA. Adjuvant-free hsp70 fusion protein system elicits humoral and cellular immune responses to HIV-1 p24. J Immunol 1996;156:873-9.
6Suzue K, Young RA. Heat shock proteins as immunological carriers and vaccines. EXS 1996;77:451-65.
7Ebrahimi SM, Tebianian M, Paykari H. Cloning, expression and purification of the truncated c-terminal fragment of Mycobacterium tuberculosis HSP70 gene in prokaryotic system as a tool for vaccine research. Middle-East J Sci Res 2010;5:128-33.
8Udono H, Srivastava PK. Heat shock protein 70-associated peptides elicit specific cancer immunity. J Exp Med 1993;178:1391-6.
9Srivastava P. Roles of heat-shock proteins in innate and adaptive immunity. Nat Rev Immunol 2002;2:185-94.
10Basu S, Binder RJ, Ramalingam T, Srivastava PK. CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 2001;14:303-13.
11Matsutake T, Srivastava PK. CD91 is involved in MHC class II presentation of gp96-chaperoned peptides. Cell Stress Chaperones 2000;5:378.
12Ebrahimi SM, Tebianian M. Heterologous expression, purification and characterization of the influenza A virus M2e gene fused to Mycobacterium tuberculosis HSP70 (359-610) in prokaryotic system as a fusion protein. Mol Biol Rep 2010;37:2877-83.
13Ebrahimi SM, Tebianian M, Toghyani H, Memarnejadian A, Attaran HR. Cloning, expression and purification of the influenza A (H9N2) virus M2e antigen and truncated Mycobacterium tuberculosis HSP70 as a fusion protein in Pichia pastoris. Protein Expr Purif 2010;70:7-12.
14Del Giudice G. Hsp70: A carrier molecule with built-in adjuvanticity. Experientia 1994;50:1061-6.
15Perraut R, Lussow AR, Gavoille S, Garraud O, Matile H, Tougne C, et al. Successful primate immunization with peptides conjugated to purified protein derivative or mycobacterial heat shock proteins in the absence of adjuvants. Clin Exp Immunol 1993;93:382-6.
16Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3 rd ed. New York: Cold Spring Harbor Laboratory Press; 2001.
17Estein SM, Cheves PC, Fiorentino MA, Cassataro J, Paolicchi FA, Bowden RA. Immunogenicity of recombinant Omp31 from Brucella melitensis in rams and serum bactericidal activity against B. ovis. Vet Microbiol 2004;102:203-13.
18Ye J, Sui YF, Chen GS, Zhang XM. Cloning and prokaryotic expression of heat shock protein 70 gene of Mycobacterium tuberculosis. Chin J Cell Mol Immunol 2003;19:443-5.
19Vorobiev DS, Kiselevskii MV, Chikileva IO, Semenova IB. Effect of recombinant heat shock protein 70 of mycobacterial origin on cytotoxic activity and immunophenotype of human peripheral blood mononuclear leukocytes. Bull Exp Biol Med 2009;148:64-7.
20Zügel U, Sponaas AM, Neckermann J, Schoel B, Kaufmann SH. gp96-peptide vaccination of mice against intracellular bacteria. Infect Immun 2001;69:4164-7.
21Suzue K, Zhou X, Eisen HN, Young RA. Heat shock fusion proteins as vehicles for antigen delivery into the major histocompatibility complex class I presentation pathway. Proc Natl Acad Sci U S A 1997;94:13146-51.
22Minton K. Antigen presentation: Shocking stimulation. Nat Rev Immunol 2004;4:162.
23Javid B, MacAry PA, Oehlmann W, Singh M, Lehner PJ. Peptides complexed with the protein HSP70 generate efficient human cytolytic T-lymphocyte responses. Biochem Soc Trans 2004;32:622-5.
24Qazi KR, Oehlmann W, Singh M, López MC, Fernández C. Microbial heat shock protein 70 stimulatory properties have different TLR requirements. Vaccine 2007;25:1096-103.
25Barrios C, Lussow AR, Van Embden J, Van der Zee R, Rappuoli R, Costantino P, et al. Mycobacterial heat-shock proteins as carrier molecules. II: The use of the 70-kDa mycobacterial heat-shock protein as carrier for conjugated vaccines can circumvent the need for adjuvants and bacillus calmette guérin priming. Eur J Immunol 1992;22:1365-72.
26Lussow AR, Barrios C, van Embden J, Van der Zee R, Verdini AS, Pessi A, et al. Mycobacterial heat-shock proteins as carrier molecules. Eur J Immunol 1991;21:2297-302.
27Qazi KR, Wikman M, Vasconcelos NM, Berzins K, Ståhl S, Fernández C. Enhancement of DNA vaccine potency by linkage of Plasmodium falciparum malarial antigen gene fused with a fragment of HSP70 gene. Vaccine 2005;23:1114-25.
28Qazi KR, Qazi MR, Julián E, Singh M, Abedi-Valugerdi M, Fernández C. Exposure to mycobacteria primes the immune system for evolutionarily diverse heat shock proteins. Infect Immun 2005;73:7687-96.
29Rahman QK, Berzins K, López MC, Fernández C. Breaking the non-responsiveness of C57BL/6 mice to the malarial antigen EB200: The role of carrier and adjuvant molecules. Scand J Immunol 2003;58:395-403.