Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 2816 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (1,341 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed591    
    Printed15    
    Emailed0    
    PDF Downloaded31    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 37  |  Issue : 3  |  Page : 406-414
 

VP1-binding protein glucose-regulated protein 78 as an important mediator for enterovirus 71 infecting human brain microvascular endothelial cells


1 Department of Clinical Laboratory, Affiliated Hospital of Guangdong Medical University, Zhanjiang; Department of Laboratory Medicine, School of Laboratory Medicine, Guangdong Medical University, Guangdong, China
2 Department of Clinic Laboratory, The Fifth Affiliated Hospital of Guangzhou Medical University, Guangzhou, China
3 Department of Microbiology, Guangdong Provincial Key Laboratory of Tropical Disease Research, School of Public Health, Southern Medical University, Guangzhou, China
4 Department of Clinical Laboratory, Affiliated Hospital of Guangdong Medical University, Zhanjiang, China

Date of Submission16-May-2019
Date of Decision26-Aug-2019
Date of Acceptance26-Oct-2019
Date of Web Publication29-Jan-2020

Correspondence Address:
Prof. Cao Hong
Department of Microbiology, Guangdong Provincial Key Laboratory of Tropical Disease Research, School of Public Health, Southern Medical University, Guangzhou 510515
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_19_194

Rights and Permissions

 ~ Abstract 


Purpose: Enterovirus 71 (EV71) is one of the main pathogens causing hand, foot and mouth disease, which could even induce severe brain damage in some patients. As the underlying mechanism of the invasion and replication process still remains largely unknown, we investigated the role of candidate proteins expressed during EV71 invasion in human brain microvascular endothelial cells (HBMECs) to delineate the pathophysiological mechanism of EV-71 infection. Materials and Methods: Ninety-one candidate EV71-associated proteins which could bind the major capsid protein (viral protein 1 [VP1]) of EV71 on the HBMEC were identified by applying an analysis of glutathione-S-transferase pull-down coupling with liquid chromatography-electrospray ionisation-tandem mass spectrometry (LC-ESI-MS/MS). Seventy-eight kDa glucose-regulated protein 78 (GRP78) binding to the VP1 protein was further validated by co-immunoprecipitation, immunofluorescence and western blot analysis. To explore the role of GRP78 in EV71 infection, GRP78 was knocked down and overexpressed in HBMEC and was verified by TCID50 assay. Results: LC-ESI-MS/MS-identified 91 proteins were subjected to gene ontology analysis, and on molecular and biological function analysis revealed GRP78 act as an important binding protein in mediating EV71 infection. In addition, immunofluorescence demonstrated the co-localisation of GRP78 and VP1 in cytoplasm of the infected HBMEC. The TCID50 assay showed that knockdown of GRP78 could attenuate the replication capacity of EV71 in HBMEC, and the overexpression could increase the virus titre in HBEMC at 24 h post-infection suggesting that GRP78 was associated with the replication capacity of EV71 in HBMEC. Conclusion: These findings provided evidence that GRP78 plays an important role during the progression of EV71 infection as a mediator in HBMEC.


Keywords: Brain damage, enterovirus 71, glucose-regulated protein 78 , human brain microvascular endothelial cells


How to cite this article:
Luo W, Liang P, Puthiyakunnon S, Yang L, Hong C. VP1-binding protein glucose-regulated protein 78 as an important mediator for enterovirus 71 infecting human brain microvascular endothelial cells. Indian J Med Microbiol 2019;37:406-14

How to cite this URL:
Luo W, Liang P, Puthiyakunnon S, Yang L, Hong C. VP1-binding protein glucose-regulated protein 78 as an important mediator for enterovirus 71 infecting human brain microvascular endothelial cells. Indian J Med Microbiol [serial online] 2019 [cited 2020 Mar 30];37:406-14. Available from: http://www.ijmm.org/text.asp?2019/37/3/406/277064





 ~ Introduction Top


Enterovirus 71 (EV71) is a single-stranded positive-sense RNA virus with a genome size of about 7.4 kb, which has been recognised as one of the causative factors of hand, foot and mouth disease (HFMD).[1],[2] EV71 infection may cause severe diseases and can even lead to complications involving central nervous system (CNS) in children.[1],[3] As for enterovirus, two possible routes by which EV71 reaches the CNS have been suggested: the EV71 either enters the CNS from the blood across the blood–brain barrier (BBB) or is transmitted to the CNS through peripheral nerves through retrograde axonal transport.[4] However, the underlying mechanism that leads to transmigration of EV71 virus particles across BBB still remains largely unclear.

Viral protein 1 (VP1) is a structural protein exposed on the surface of EV71, which is one of the key virulence factors in the pathogenesis of EV71 during the recognition process of the virus entering into host cells.[5],[6] Our previous study showed that EV71 could infect and replicate in human brain microvascular endothelial cells (HBMEC),[7] which is the prime component of BBB.[8] In this study, glutathione-S-transferase (GST) pull-down coupling with liquid chromatography-electrospray ionisation-tandem mass spectrometry (LC-ESI-MS/MS) method identified EV71-associated proteins in HBMEC. Among these proteins, glucose-regulated protein 78 (GRP78) was further verified as a potential VP1-binding protein, which was knocked down and overexpressed in HBMEC, and the invasion ability of EV71 in HBMEC was measured. In this study, we investigated the major virulence factors expressed on the surface of the virus and associated proteins that could play a significant role in viral invasion and further replication of the viral particles inside the host cells.


 ~ Materials and Methods Top


Materials

HBMEC was a generous gift from professor Huang (University of Southern California, USA), and human embryonic rhabdomyosarcoma (RD) cells were obtained from the Centre for Disease Control and Prevention of Guangdong Province, respectively. EV71 (KC122766) isolated from a severe HFMD patient was previously conserved in our laboratory. The ProteoExtract® Subcellular Proteome Extraction Kit was purchased from MerckMillipore (Billerica, MA, USA). PCMV-HA tag vector and PCMV-Flag tag vector were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Rabbit anti-human EV71 Monoclonal Antibody, Pierce GST Protein Interaction Pull-Down Kit, Pierce BCA Protein Assay Kit, Pierce C18 Spin Columns and Halt™ Protease and Phosphatase Inhibitor Cocktail (100×) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). EV71 VP1 recombinant protein was purchased from Abnova (Taipei, Taiwan). The sequence grade trypsin protease was purchased from Promega (Madison, WI, USA). Dithiothreitol (DTT) and iodoacetamide (IAA) were purchased from GE Healthcare (Little Chalfont, Buckinghamshire, UK). Trifluoroacetic acid, formic acid, acetonitrile and ammonium bicarbonate were purchased from Sigma-Aldrich (St. Louis, MO, USA). The Dulbecco's Modified Eagle Medium and foetal bovine serum were purchased from GIBCO (Grand Island, NY, USA).

Cell culture and treatment

The HBMECs were cultured and treated with EV71 particles as described previously.[9] The cells exhibited the typical characteristics of brain endothelial cells with tight junctions and apical-to-basal polarity.[10] EV71 virus was amplified using RD cells, and the viral titres were estimated as described previously.[9],[11] In all experiments, HBMECs were infected with the respective EV71 virus at a multiplicity of infection (MOI) of 5 PFU/cell.

Protein extraction and glutathione-S-transferase pull-down assay

Subcellular proteins of HBMEC were extracted following the manufacturer's instructions of ProteoExtract® Kit (Millipore, USA). The extracted proteins in the supernatant were kept for further GST pull-down analysis. GST pull-down assay was conducted following the instructions of pierce GST Protein Interaction Pull-Down Kit. EV71 VP1 recombinant protein (Taipei, Taiwan) was used as GST-fusion probe protein. Candidate VP1-binding proteins obtained from GST pull-down were quantified by a BCA protein quantification kit (Thermo). The VP1-binding protein was used for further study, including LC separation and MS analysis.

Liquid chromatography separation and mass spectrometry analysis

Eluted protein (100 μg) was reduced by 10 mmol/L DTT, alkylated by 20 mmol/L IAA and then digested by trypsin (Promega) at 37°C overnight. The peptides were desalted using C18 spin columns (Thermo) and were redissolved in 2% acetonitrile, 0.1% formic acid and loaded on a ChromXP C18 (3 μm, 120 Š) nanoLC trap column. The online trapping and desalting procedure were carried out at 2 μL/min for 10 min, with 0.1% formic acid in 98% acetonitrile. An elution gradient of 5%–35% acetonitrile (0.1% formic acid) in a 90 min gradient was used on an analytical column (3 μm, 100 Š, 75 μm i.d. ×15 cm, Acclaim PepMap100, C18, Dionex). MS/MS analysis was performed with a TripleTOF 5600 System (AB SCIEX, Concord, ON). Data were acquired using an ion spray. The MS was operated with TOF-MS scans. Survey scans were acquired in 250 ms, and a maximum product ion scans were collected if counts reached a threshold of 150 counts/s with a +2 to +5 charge state. A rolling collision energy setting was applied to all precursor ions for collision-induced dissociation. Proteins were identified by searching against the UniProt human protein database with MASCOT search engine.

Co-IP analysis

GRP78 binding to VP1 was further validated following the instructions of Co-IP kit (Waltham, MA, USA). PCMV-HA tag vector and PCMV-Flag tag vector were used for the expression and purification of VP1 and GRP78 proteins, respectively. For Co-IP, subcellular proteins of HBMEC were extracted as described above and mixed with the VP1-HA-tag recombinant protein. EV71 sample was purified and mixed with GRP78-Flag-tag recombinant protein. The mixture was incubated with antibody against VP1 or GRP78 overnight at 4°C and then added with Protein A/G agarose beads for additional gentle rocking for 2.5 h at 4°C. The IgG was used to serve as negative control. After centrifugation for five times at 1000 g for 5 min and washing with lysis buffer, the pellet was resuspended with 30 μl of sodium dodecyl sulphate (SDS) sample buffer. All the samples were analysed by SDS-PAGE and western blot (WB) analysis as described below.

Immunofluorescence assay

HBMEC (1 × 105) was placed on a coverslip and allowed for virus adhesion for 24 h. The cells were washed with Phosphate Buffered Saline (PBS) for three times and fixed with 4% paraformaldehyde for 20 min, blocked with 1% bovine serum albumin for 1 h. The treated cells were incubated with the rabbit anti-human GRP78 monoclonal antibody and rabbit anti-human EV71 monoclonal antibody overnight at 4°C. After washing, cells were stained with PE-labelled and FITC-labelled donkey anti-rabbit IgG and then washed for three times and examined under a fluorescent microscope (LeicaDMI3000B, German).

Overexpression and knockdown of glucose-regulated protein 78 in human brain microvascular endothelial cells

Three pairs of RNAi primers and overexpression vector were synthesised by Ribo Limited Co. Overexpression vector (pcnda3.1-GRP78) and the small interfering RNA (siRNA) of GRP78 were transfected, respectively, into HBMEC using Lipofectamine 2000 (Invitrogen, USA) according to the manufacture's recommendations. The interference efficiency and expression were tested by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and WB.

TCID50 assay

HBMECs were treated with siRNA-3 oligonucleotides, a universal sequence that had no significant homology to any known human mRNA in the databases, empty vector and overexpression vector targeted GRP78 for 24 h. Then, the culture medium was discarded and cultured with fresh medium for another 24 h. After the GRP78 siRNA group (HBMEC infected with GRP78 siRNA), the scramble control group (HBMEC infected with negative control), the control group (uninfected HBMEC), empty vector and overexpression vector groups were infected EV71 particles (MOI = 5) at 37°C with 5% CO2 for 1.5 h, and the virus supernatant was discarded. HBMECs were washed with hank's solution for once, and the time of infection was calculated at this time point. Finally, the culture medium and cells among the four groups at 1 h and 24 h were collected for determination of the virus titre of EV71 by a TCID50 assay. Briefly, the viral titres were determined on RD cell monolayers by means of the TCID50 standard method and calculated using the Reed–Muench protocol.[12]

Reverse transcription-quantitative polymerase chain reaction and Western blot analysis

For quantitative RT-PCR, total mRNA of the treated HBMECs was extracted using RNAesy Kit (QIAGEN). Each sample was measured in triplicate. The primers for GRP78 (primer F: GAGAAGTTTGCTGAGGAAGA, primer R: GAAAGTTTACCTCCCAGCTT) were designed using DNASIS Max. Glyceraldehyde -3-phosphatedehydrogenase (GAPDH) was chosen as the reference gene. PCR reactions were conducted in 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA). The cycle conditions included an initial denaturation step at 95°C for 2 min, followed by 40 amplification cycles for 15 s at 95°C and 1 min at 60°C. Relative expression for mRNA was determined using 2–ΔΔCt method. All reactions were performed in triplicate. Proteins of HBMEC were extracted using PhosphoSafe™ lysis reagent for WB analysis. The proteins were boiled, electrophoresed by SDS-PAGE and transferred on to Polyvinylidene Difluoride (PVDF) membranes. The membranes were incubated with antibodies against VP1, GRP78 and GAPDH (diluted by TBST at 1:1000) respectively, then washed and incubated with goat anti-mouse antibody (diluted by TBST at 1:3000). Protein bands were visualised using Emitter-coupled logic (ECL) substrate and the Image Quant RT ECL System (GE Healthcare).

Statistical analysis

Data were analysed by one-way ANOVA tests. SPSS software (version 13.0) SPSS: Statistical Package for Social Sciences, IBM was used for statistical analysis and P < 0.05 was considered to be statistically significant.


 ~ Results Top


Identification of viral protein 1-binding proteins

GST-tagged VP1 protein was used as a bait protein to capture the proteins extracted from HBMEC. LC-ESI-MS/MS analysis identified 91 common proteins in two biological replicates [Table 1]. The gene ontology analysis of 91 proteins is shown in [Figure 1]a, [Figure 1]b, [Figure 1]c, which demonstrated their specific location after cellular component analysis, binding efficiency to various components by molecular function analysis and their specific cellular and biological functions by biological process analysis.
Table 1: Differential proteins identified by mass spectrometry based on glutathione-S-transferase-pull-down analysis

Click here to view
Figure 1: Gene ontology enrichment of candidate viral protein 1-binding proteins. Functional enrichment of candidate viral protein 1-binding proteins by gene ontology analysis. (a) 22% of the 91 potential viral protein 1 candidate-binding proteins were located at the extracellular or plasma membrane. (b) Viral protein 1-binding proteins were mainly enriched as anatomical structure development and biosynthesis process-related proteins. (c) Viral protein 1-binding proteins were mainly enriched as ion-binding and RNA-binding proteins

Click here to view


Identification of glucose-regulated protein 78 as an enterovirus 71-binding protein

The interaction between 78 kDa GRP78 and VP1 was further verified using GST-Pull down and WB analysis. After incubating the extracted protein with VP1, the VP1-binding proteins were analysed by WB using anti-GRP78 antibody, which could be observed as an obvious band in the second lane of immunoblot [Figure 2]a. GRP78 as a VP1-binding protein was further verified by Co-IP coupled with WB analysis. IgG was used as negative control. As shown in [Figure 2]b, after interacting with VP1-HA-tag protein which was used as a bait protein, western blotting performed with anti-GRP78 antibody showed positive expression results in the input lane and GRP78 lane. Similarly, when using the GRP78-Flag-tag protein as a bait protein, positive expression results were observed in the input lane and VP1 lane, whereas the IgG lane showed a negative result [Figure 2]c. In addition, immunofluorescence demonstrated the co-localisation of GRP78 and VP1 as shown in [Figure 2]d. On the basis of the above results, it could be suggested that GRP78 was a binding protein of EV71 VP1.
Figure 2: Glucose-regulated protein 78 was verified as viral protein 1-binding protein by Co-IP assay combine with immunofluorescence analysis (a) glutathione-S-transferase pull-down assay confirmed that glucose-regulated protein 78 is a viral protein 1-binding protein. (b and c) Validation of glucose-regulated protein 78 as a viral protein 1-binding protein by Co-IP coupled with western blot analysis. IgG was used as negative control. (d) Immunofluorescence experiments confirmed the co-localisation of glucose-regulated protein 78 and viral protein 1

Click here to view


Knockdown of glucose-regulated protein 78 in human brain microvascular endothelial cell

HBMEC was treated with three 200 nmol/L siRNA oligonucleotides, targeted GRP78 for 24 h and cultured with fresh medium for another 24 h. To develop the optimal transfection system, the transfection efficiency of siRNA in HBMEC was determined with the RT-qPCR and WB analysis. As shown in [Figure 3]a and [Figure 3]b, the maximal gene expression interference efficiency occurred when the siRNA-3 concentration was 200 nM (P < 0.05). Therefore, the following RNAi experiment was performed with this siRNA-3 transfection system.
Figure 3: Influence of glucose-regulated protein 78 knockdown and overexpression on enterovirus 71 replication in human brain microvascular endothelial cell by TCID50 analysis The relative RNA (a) and protein expression (b) of glucose-regulated protein 78 treated with glucose-regulated protein 78-small interfering RNA. The enterovirus 71 titre in the intracellular (c) and extracellular (d) compartments of human brain microvascular endothelial cells treated with the glucose-regulated protein 78 small interfering RNA s detected by a TCID50 assay. The relative RNA (e) and protein expression (f) of glucose-regulated protein 78 treated with glucose-regulated protein 78 overexpression vector. The enterovirus 71 titre in the intracellular (g) and extracellular (h) compartments of human brain microvascular endothelial cells treated with the glucose-regulated protein 78 overexpression vector detected by a TCID50 assay

Click here to view


Overexpression of glucose-regulated protein 78 in human brain microvascular endothelial cell

An overexpression vector (pcnda3.1-GRP78) was transfected into HBMECs using Lipofectamine 2000, and then, the GRP78 expression was tested in mRNA and protein level using RT-qPCR and WB, respectively. As shown in [Figure 3]e, when compared to the control groups, the mRNA expression level of GRP78 increased significantly. Similarly, WB results showed that the GRP78 protein level in the cells transfected with pcnda3.1-GRP78 was significantly higher than that in the control groups [Figure 3]f.

Glucose-regulated protein 78 was associated with the replication capacity of enterovirus 71 in human brain microvascular endothelial cell

The viral titre was evaluated by TCID50 assay (in terms of TCID50 values) to demonstrate the effects of GRP78 on the replication of strain EV71 in HBMEC. As shown in [Figure 3]c and d, at 1 h post-infection, the virus titres in both of the intracellular and extracellular regions had no significant difference between the EV71-control, scramble control and GRP78 knockdown group. However, at 24 h post-infection, the virus titres in both of the intracellular and extracellular GRP78 knockdown group were obviously lower than the EV71-control and scramble control groups (P < 0.05). As shown in [Figure 3]g and h, at 24 h post-infection, the virus titres in both of the intracellular and extracellular GRP78 overexpression group were obviously higher than the EV71-control and scramble control group (P < 0.05).


 ~ Conclusion Top


EV71 infection could lead to HFMD with multiple symptoms. Moreover, EV71 can also penetrate across brain-vascular barrier and cause severe neurological diseases in children. However, the underlying mechanisms for EV71 invading into the brain-vascular barrier and leading to brain damage remains unclear. Although VP1 existed as polymers on the surface of EV71, the consensus that VP1 is an important site for interaction with host cells.[13],[14]

In this study, we identified 91 candidate EV71-associated proteins which could bind VP1 on the HBMEC by GST pull-down assay combined with MS analysis (Tab. 1). Among these identified candidate EV71-associated proteins, GRP78, also referred to as binding immunoglobulin protein (BiP) or heat-shock 70-kDa protein A5 (HSPA5), an HSP70 family member and ER chaperone best known for its coordination of the unfolded protein response.[15] It is primarily targeted to the ER. Recent reports have shown that GRP78 has receptor-like function associated with cellular proliferation and survival.[16],[17],[18] Research results also demonstrated that EV71 infection increase the GRP78/BiP protein level in RD cells.[19] However, the role of GRP78 in EV71 infecting HBMEC is not clear. Therefore, to explore the role of GRP78 in EV71-infecting HBMEC, the interaction between GRP78 protein of HBMEC and VP1 was further validated by Co-IP and WB assay [Figure 2]. The data showed that GRP78 could interact with EV71 VP1 protein. In addition, the immunofluorescence results showed that GRP78 was not expressed on the surface of HBMEC but mainly in the cytoplasm. The co-localisation of GRP78 and VP1 also suggested the interaction between GRP78 and VP1.

The TCID50 assay showed that knockdown of GRP78 could attenuate the replication capacity of EV71 in HBMEC, and the overexpression of GRP78 could increase the virus titre in HBMEC at 24-h post-infection. However, the treatment of siRNA or overexpression has no significant effect on the replication capacity of EV71 in HBMEC at 1 h. These results suggested that the redistribution of GRP78 could be a key step of EV71 replication in HBMEC, but not act as an attachment receptor for EV71 entry. Our study is also the first to demonstrate that GRP78 plays an important role in the infectivity of EV71 in HBMEC.

In summary, our study demonstrated GRP78 acts as a VP1-binding protein in HBMEC. Further functional analysis identified that GRP78 mediates the replication capacity of EV71 in the HBMEC, and GRP78 can significantly enhances EV71 infectivity in HBMEC. GRP78 binding to VP1 may promote EV71 invasion of HBMEC, which may further lead to CNS diseases. Our findings also provide scientific basis of potential therapeutic targets for prevention and treatment of EV71-induced brain damage. However, the detailed mechanisms involved remain to be fully elucidated.

Financial support and sponsorship

This work was supported by the National Natural Science Foundation of China [Grant numbers 81301478]; the Project of Guangdong Natural Science Foundation [Grant numbers 2016A030310033] and the Project of Shenzhen Basic Research Plan [Grant numbers JCYJ20150402102135491].

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Solomon T, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, Ooi MH. Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet Infect Dis 2010;10:778-90.  Back to cited text no. 1
    
2.
Yang F, Ren L, Xiong Z, Li J, Xiao Y, Zhao R, et al. Enterovirus 71 outbreak in the People's Republic of China in 2008. J Clin Microbiol 2009;47:2351-2.  Back to cited text no. 2
    
3.
Mao LX, Wu B, Bao WX, Han FA, Xu L, Ge QJ, et al. Epidemiology of hand, foot, and mouth disease and genotype characterization of Enterovirus 71 in Jiangsu, China. J Clin Virol 2010;49:100-4.  Back to cited text no. 3
    
4.
Wang YF, Chou CT, Lei HY, Liu CC, Wang SM, Yan JJ, et al. A mouse-adapted enterovirus 71 strain causes neurological disease in mice after oral infection. J Virol 2004;78:7916-24.  Back to cited text no. 4
    
5.
Zhang B, Wu X, Huang K, Li L, Zheng L, Wan C, et al. The variations of VP1 protein might be associated with nervous system symptoms caused by enterovirus 71 infection. BMC Infect Dis 2014;14:243.  Back to cited text no. 5
    
6.
Plevka P, Perera R, Cardosa J, Kuhn RJ, Rossmann MG. Crystal structure of human enterovirus 71. Science 2012;336:1274.  Back to cited text no. 6
    
7.
Luo WY, Zhao W, Peng L, Yu JY, Zhang LK, Zhang WB, Cao H. Enterovirus 71 infecting human brain microvascular endothelial cells: A preliminary study. Acad J Second Military Med Univ 2014;35:240-5.  Back to cited text no. 7
    
8.
Czupalla CJ, Liebner S, Devraj K.In vitro models of the blood-brain barrier. Methods Mol Biol 2014;1135:415-37.  Back to cited text no. 8
    
9.
Luo WY, Zhong JY, Zhao W, Liu JJ, Zhang RL, Peng L, et al. Proteomic analysis of human brain microvascular endothelial cells reveals differential protein expression in response to enterovirus 71 infection. Biomed Res Int 2015;(Volume-2015):864169.  Back to cited text no. 9
    
10.
Chen SH, Stins MF, Huang SH, Chen YH, Kwon-Chung KJ, Chang Y, et al. Cryptococcus neoformans induces alterations in the cytoskeleton of human brain microvascular endothelial cells. J Med Microbiol 2003;52:961-70.  Back to cited text no. 10
    
11.
Huang SC, Chang CL, Wang PS, Tsai Y, Liu HS. Enterovirus 71-induced autophagy detectedin vitro andin vivo promotes viral replication. J Med Virol 2009;81:1241-52.  Back to cited text no. 11
    
12.
Blake K, O'Connell S. Virus culture. In: Harper DR, editor. Virology, Lab Fax. Oxford: Bios Scientific Publishers; 1993. p. 81-122.  Back to cited text no. 12
    
13.
Tung WS, Bakar SA, Sekawi Z, Rosli R. DNA vaccine constructs against enterovirus 71 elicit immune response in mice. Genet Vaccines Ther 2007;5:6.  Back to cited text no. 13
    
14.
Chen HF, Chang MH, Chiang BL, Jeng ST. Oral immunization of mice using transgenic tomato fruit expressing VP1 protein from enterovirus 71. Vaccine 2006;24:2944-51.  Back to cited text no. 14
    
15.
Pfaffenbach KT, Lee AS. The critical role of GRP78 in physiologic and pathologic stress. Curr Opin Cell Biol 2011;23:150-6.  Back to cited text no. 15
    
16.
Gonzalez-Gronow M, Selim MA, Papalas J, Pizzo SV. GRP78: A multifunctional receptor on the cell surface. Antioxid Redox Signal 2009;11:2299-306.  Back to cited text no. 16
    
17.
Sato M, Yao VJ, Arap W, Pasqualini R. GRP78 signaling hub a receptor for targeted tumor therapy. Adv Genet 2010;69:97-114.4.  Back to cited text no. 17
    
18.
Ni M, Zhang Y, Lee AS. Beyond the endoplasmic reticulum: Atypical GRP78 in cell viability, signalling and therapeutic targeting. Biochem J 2011;434:181-8.  Back to cited text no. 18
    
19.
Jheng JR, Lau KS, Tang WF, Wu MS, Horng JT. Endoplasmic reticulum stress is induced and modulated by enterovirus 71. Cell Microbiol 2010;12:796-813.  Back to cited text no. 19
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04