Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 246 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (2,037 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusions
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed1004    
    Printed24    
    Emailed0    
    PDF Downloaded58    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 37  |  Issue : 3  |  Page : 337-344
 

Geographically distinct North-East Indian Helicobacter pylori strains are highly sensitive to clarithromycin but are levofloxacin resistant


1 Amity Institute of Biotechnology, Amity University, Noida, Uttar Pradesh, India
2 Centre of Bioinformatics, University of Allahabad, Allahabad, Uttar Pradesh, India
3 Division of Bacteriology, National Institute of Cholera and Enteric Diseases, Kolkata, West Bengal, India
4 Department of Gastroenterology, Gauhati Medical College, Guwahati, Assam, India
5 Department of Gastroenterology and Hepatology, Max Super Specialty Hospital, Vaishali, Ghaziabad, Uttar Pradesh, India

Date of Submission25-Apr-2019
Date of Decision29-Jun-2019
Date of Acceptance12-Nov-2019
Date of Web Publication29-Jan-2020

Correspondence Address:
Dr. Rajashree Das
Amity Institute of Biotechnology, Amity University, Noida, Uttar Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_19_158

Rights and Permissions

 ~ Abstract 


Purpose: Helicobacter pylori causes various gastro-intestinal diseases. Antibiotic resistance to commonly used antibiotics for the treatment of H. pylori infection is the major cause for treatment failure. The aim of this study is to determine the antimicrobial susceptibility pattern for clarithromycin and levofloxacin and find the evolutionary relationship of the partial sequence of 23S rRNA and gyraseA gene of H. pylori by phylogenetic analysis. Materials and Methods: A total of 46 H. pylori strains were tested for clarithromycin and levofloxacin susceptibility pattern and phylogenetic tree were reconstructed by PhyML software. Results: In this study, we observed that only 6.5% of North-East Indian H. pylori strains were resistant for clarithromycin showing mutation at A2143G and T2182C positions of 23S rRNA gene. Resistance for levofloxacin was observed in 89.1% of the H. pylori strains showing mutations at asparagine to lysine at 87 and aspartic acid to glycine/tyrosine/asparagine at 91 positions of gyraseA gene. The phylogenetic tree of the partial sequence of 23S rRNA and gyraseA gene depicts that the North-East Indian strains falls in different cluster when compared to other countries. Conclusions: Resistance for clarithromycin was less in North-East Indian strains but high for levofloxacin indicating that first-line therapy may be best and effective for eradication of H. pylori in this region. This study is the first report that showed antibiotic susceptibility pattern for clarithromycin and levofloxacin by mutation analysis. By partial sequencing of 23s rRNA and gyraseA gene, we found that North-East Indian strains are geographically distinct.


Keywords: Clarithromycin, Helicobacter pylori, levofloxacin, phylogeny, resistance


How to cite this article:
Mahant S, Sharma AK, Gehlot V, Mukhopadhyay AK, Chhawchharia A, Dutta S, Agarwal A, Som A, Das K, Das R. Geographically distinct North-East Indian Helicobacter pylori strains are highly sensitive to clarithromycin but are levofloxacin resistant. Indian J Med Microbiol 2019;37:337-44

How to cite this URL:
Mahant S, Sharma AK, Gehlot V, Mukhopadhyay AK, Chhawchharia A, Dutta S, Agarwal A, Som A, Das K, Das R. Geographically distinct North-East Indian Helicobacter pylori strains are highly sensitive to clarithromycin but are levofloxacin resistant. Indian J Med Microbiol [serial online] 2019 [cited 2020 Aug 14];37:337-44. Available from: http://www.ijmm.org/text.asp?2019/37/3/337/277063





 ~ Introduction Top


Helicobacter pylori is a Gram-negative microaerophilic bacteria infecting one half of the world's population[1] and plays an important role in the pathogenesis such as chronic gastritis, peptic ulcer diseases, gastric adenocarcinoma and gastric mucosa-associated lymphoid tissue lymphoma.[2] Eradication of the H. pylori is the only way to cure several gastro-intestinal (GI) diseases caused by H. pylori infection.[3] Treatment for the H. pylori infection is done with triple therapy, which is the combination of proton-pump inhibitor (PPI) and amoxicillin (AMX) or metronidazole (MTZ) and clarithromycin (CLR) given to the patients for 10–14 days.[4] The eradication rate of H. pylori decreases with the emergence of the strains resistant towards the antibiotics. Resistance to the most frequently used antibiotics such as MTZ (10%–90%), CLR (0%–15%) and AMX (0%–1%) has been shown to be variable and dissimilar in different region within the country.[5] Among all antibiotics CLR is a key antibiotic for the treatment regime because of its low resistance rate as compared to other antibiotics, and it is also better absorbed in the gastric mucosa, and more stable at lower pH.[6] However, if the resistance toward CLR is higher than 15%–20% then it causes major obstacle in the eradication of H. pylori and an urgent need for an alternative therapy is required for the treatment.[6]

Resistance to CLR is associated with one of three known point mutations in the V domain of the 23S rRNA gene of H. pylori: Adenine to Guanine at position 2142 (A2142G) and 2143 (A2143G) and Adenine to Cytosine at position 2182 (T2182C).[7] The other point mutation observed in 23S rRNA genes are T2190C, C2195T, C2611A and A2223G,[7] but it is reported that the highest proportion of resistance is caused due to the point mutation at 2142 and 2143 positions which has been shown through mutagenesis studies.[8]

The drug CLR is commonly used among the local population for the cure of other diseases other than gastrointestinal diseases, which may be the possible reason for increasing resistance towards CLR and its resistance also varies geographically which has become a major challenge for the successful treatment of H. pylori-related GI diseases.[9] The CLR resistance varies between 0% and 35% in various countries.[9] In India, the high rate of resistance was observed in Mumbai with 91%,[9] Hyderabad (26%),[9] Gujarat (58.85%)[9] and Delhi (11.8%),[9] whereas Kolkata strains showed 0% resistance towards CLR.[9] Levofloxacin (LEV) is another drug of choice for the eradication of H. pylori used as a second-line therapy in other countries.[10] LEV is a levorotary isomer of ofloxacin with known broad activity against Gram-negative and Gram-positive bacteria.[10] The H. pylori strains isolated from India and Bangladesh showed the emerging LEV resistance due to the mutation in gyraseA gene of H. pylori at amino acid position 87 asparagine to lysine (N87K), at 88 alanine to valine (A88V) and at 91 position aspartic acid to glycine/asparagine/tyrosine (D91G/N/Y).[10]

The analysis of 16S rRNA gene sequence is the most common method used for the molecular study of the phylogeny of bacteria, but in H. pylori other genes such as 23S rRNA, ureB and gyraseB[11] have been used in phylogenetic studies. Currently, there are no such studies referred from India on the phylogenetic analysis of partial sequence of 23S rRNA and gyraseA gene of H. pylori.

Hence, the increasing resistance rate of CLR and LEV in India along with geographical differences in the resistance scenario of these antibiotics and lack of data from North-East India motivated us to determine the prevalence of antimicrobial resistance to commonly used antibiotics against the North-East Indian H. pylori strains, to identify the genetic basis of the resistance pattern of CLR and LEV and also to find the evolutionary relationship of the North-East Indian strains by reconstructing phylogenetic tree.


 ~ Materials and Methods Top


Patients

The study was conducted on the patients who were suffering from various GI diseases and visited Gauhati Medical College, Guwahati, Assam. A total of 150 patients were enrolled in the study and were selected as per the inclusion and exclusion criteria. Inclusion criteria: patients who were enrolled in the study were aged between 18 and 88 years with the symptom of duodenal or gastric ulcer/gastritis/gastric adenocarcinoma/non-ulcer dyspepsia, and no antimicrobial therapy to eradicate H. pylori infection in the last 4 weeks. Exclusion criteria: any previous gastric surgery, use of any bismuth, any antimicrobial agents, receptor antagonists or PPI within 4 weeks before endoscopy or any other medical illness, namely cardiac, respiratory, renal and liver diseases.

Biopsy collection

After 6 h of fasting, the endoscopy was performed at Gastroenterology Department, Gauhati Medical College, Guwahati, Assam. Antral biopsies from each patient were collected in PBS (Phosphate Buffer Saline) and in Transport Media ( Brucella More Details broth + Glycerol) for further analysis. All the collected biopsies were transported to Molecular Bacteriology Laboratory, Amity Institute of Biotechnology, Amity University, Noida from Guwahati, Assam.

Ethics statement

This study was approved by the Institutional Ethics Committee of the Amity University Noida. Uttar Pradesh. The patients who were enrolled in the study have signed consent approved by the Institutional Ethical Committee.

Helicobacter pylori culture

The biopsies which were collected in Transport media (Brucella broth + Glycerol) were transported to Amity University, Noida, in dry ice. The biopsies were smeared on brain-heart infusion (BHIA) agar (Becton Dickinson Spark, MD) supplemented with 5% horse serum, 0.4% IsoVitaleX™ (Becton Dickinson), amphotericin B (8 μg/ml), trimethoprim (5 μg/ml) and vancomycin (6 μg/ml). Plates were incubated at 37°C for 3–6 days under micro-aerophilic condition (5% O2, 10% CO2) in a double gas incubator (Heracell™ 150i; Thermo Fisher Scientific, Langenselbold, Germany). The H. pylori colonies were identified as per the colony morphology, Gram staining, positive urease, oxidase and catalase test. The suspension of H. pylori was stored in −80°C in BHIA broth containing 20% glycerol.

Determination of minimum inhibitory concentration for clarithromycin and levofloxacin

The cultures which were stored in −80°C were streaked on BHIA agar plate supplemented with horse serum and were incubated for 24 h under microaerophilic condition. The exponentially grown H. pylori cultures were suspended in PBS and were adjusted to 2 McFarlnd turbidity; and 1–3 μl of the suspension was spotted on the antibiotic-containing agar plate and were incubated at 37°C under microaerophilic condition for 72 h.[12]

MIC for CLR (Abbott Laboratories, Abbott Park, IL) and LEV (Sigma, St Louis, MO, USA) were determined by agar dilution method as per the European Committee on Antimicrobial Susceptibility Testing guidelines.[12] The H. pylori isolates were considered to be resistance at MIC of >0.5 μg/ml for CLR[12] and at >1 μg/ml for LEVO.[12] All the experiments were repeated twice, and H. pylori ATCC700392 were used as a reference strain.

Genomic DNA extraction and Helicobacter pylori identification

The genomic DNA was isolated from all the biopsies by QIAamp® DNA Mini kit as per the manufacturer's instruction. The total DNA concentration was determined by NanoDrop 1510 (IS10-03571C, Multiskan GO) and the isolated genomic DNA was stored at −20°C for future use:

For molecular confirmation of H. pylori in the samples, the urease gene was amplified using the primers sequence of UreBF 5'-CGTCCGGCAATAGCTGCCATAGT3' and UreBR 5'GTAGGTCCTGCTACTGAAGCCTTA 3' with the amplicon size of 480 bp.[13] The polymerase chain reaction (PCR) was performed in a final volume of 20 μl containing ×10 PCR buffer, 10 pmol of each primer, 2 mM MgCl2, 200 μM each deoxyribonucleotide triphosphate (dNTPs), 1.5U Taq DNA polymerase and 10 ng of each DNA sample. PCR was performed in a thermocycler (Eppendorf); initial denaturation for 2 min at 96°C was followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 40 s and final extension of 72°C for 10 min. The PCR products were examined on 1% agarose gel according to the standard procedure. H. pylori strain 26695 was used as a reference strain.

Detection of 23S rRNA gene of Helicobacter pylori for conforming the clarithromycin resistance

The PCR of 23S rRNA gene was performed to detect the specific mutations for CLR resistance with the primer set 5'GGCTCTTTGAGTCCTTTAGGACAA-3' forward sense (positions 2020–2044 of U27270) and 5'-CTCCATAAGAGCCAAAGCCCTTACT-3' reverse antisense (position 2612–2636 of U27270). The PCR was carried out in 20ul reaction containing 10 pmol dNTP (Bangalore Genei, Bangalore, India), 10 pmole primer set (Sigma Aldrich), 1.5U Taq DNA polymerase (Bangalore Genei) and 10 ng of H. pylori-positive genomic DNA. The PCR reaction was performed in Eppendorf Thermocycler (vapo.protect™) for 35 cycles under the following cycling conditions 94°C for 1 min, 60°C for 1 min and 72° for 1 min. The product was finally analysed in 1% agarose gel stained with ethidium bromide and 26695 strain of H. pylori was used as a reference strain.

Polymerase chain reaction restriction fragment length polymorphism analysis to find the mutation at 2142 and 2143 position of 23S rRNA gene

The most common mutations associated with the CLR resistance are A to G at 2142 and A to G at 2143 positions and to check these most common mutation in the CLR resistant mutants the restriction endonuclease BsaI and BbsI were used, respectively. About 8 μl of the purified PCR product was incubated with BsaI for 24 h at 50°C and for 24 h at 37°C with BbsI. If the PCR product contains the mutation at A to G at 2143 it is expected to yield three fragments (103, 205 and 316 bp) when digested with BsaI and if the mutation is at A to G at 2142 positions then the PCR product is expected to yield two fragments (516 and 101 bp) when digested with BbsI.

23S rRNA gene sequencing and sequence analysis

To detect point mutations associated with CLR resistance the PCR products were purified using a QIAquick PCR Purification kit (QIAGEN, Hilden, Germany). The purified product was further sequenced by ABI sequencer 3100XL consisting of Big DyeR Terminator (PerkinElmer) with Ampli Taq FS. The sequence was edited after aligning with SeqMan program (DNASTAR, Inc., Madison, WI, USA). Sequence analysis was performed by CLUSTAL OMEGA, and the phylogenetic tree was reconstructed to find the evolutionary relationship of the partial sequence of 23S rRNA gene of H. pylori by PhyML software using the TN93 model.[14] Sequence of U27270 was taken as the reference sequence.

Detection of mutation in gyraseA gene of Helicobacter pylori for the conforming the levofloxacin resistance

The PCR of gyrase A gene was performed to detect the specific point mutations for LEV resistance with the primer gyrA (forward), 5'-TTTRGCTTATTCMATGAGCGT-3'; gyrA (reverse), 5'-GCAGACGGCTTGGTARAATA-3' to give the amplicon size of 448 bp. PCR was performed for 35 cycles of denaturation at 94°C for 10 sec, annealing at 55°C for 30 secs, extension at 72°C for 45 s and a final extension for 72°C for 10 min. All the PCR products were purified by QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany) as per the manufacturer's instruction. The purified product was further sequenced by ABI sequencer 3100XL consisting of Big DyeR Terminator (PerkinElmer) with Ampli Taq FS. The sequence was edited after aligning with SeqMan program (DNASTAR, Inc., Madison, WI, USA). The sequences obtained were compared with the published sequences of the H. pylori gyraseA gene (HP0701) to find the four mutations which are mainly responsible for LEV resistance, amino acid positions 87 (N to K), 88 position (A to V) and 91 (D to G/N/Y).[15]

Phylogenetic analysis of the partial sequence of 23S rRNA and gyraseA genes of Helicobacter pylori strains of North East India

To determine the phylogenetic origin of the H. pylori strains of North-East India 23S rRNA gene and gyraseA gene were PCR amplified using the primer listed above and sequenced as described previously. The sequences of 23S rRNA and gyraseA genes were retrieved and a tree was reconstructed by PhyML software using TN93 model with gamma distribution. The tree was generated in Newick format, visualised in Treeview and further modified by iTOL (interactive Tree of Life) package.

Statistical analysis

The data were processed with the statistical programme IBM SPSS Statistics for Windows ver. 20.0 (IBM Corp., Armonk, NY, USA). The different groups were evaluated using the Chi-square or Fisher's exact test. A value of P < 0.05 was considered statistically significant.


 ~ Results Top


Population characteristics and susceptibility to clarithromycin

Out of the total H. pylori positive isolates 46 were available for CLR and LEV susceptibility testing within the age group of 18–80 years, 32 were male (mean ± standard deviation [SD] age, 44.9 ± 15.9 years) and 14 were female (mean ± SD age, 43 ± 13 years) suffering from various GI diseases, namely gastric erosion (n = 28), deformed duodenitis and deformed duodenum (n = 11), gastric ulcer (n = 5), normal (n = 1) and miscellaneous (n = 1). The biopsies which were transported in Transport Media were used to isolate the H. pylori by culture-based method. 11.3% (11/97) of the biopsies transported in transport media were positive for H. pylori by culture and were further tested for CLR and LEV susceptibility test by agar dilution method. All the culture-positive H. pylori strains were susceptible for CLR at the MIC of <0.125 μg/ml, whereas 36% (4/11) isolates of H. pylori were resistant for LEV at the MIC of >1 μg/ml. The genomic DNA was isolated from the H. pylori cultures. Among the biopsies which were transported in PBS, 35 genomic DNA shows the presence of H. pylori by urease PCR. Therefore the total number of H. pylori-positive genomic DNA available for antibiotic susceptibility pattern by molecular method was 46.

Polymerase chain reaction restriction fragment length polymorphism analysis for the detection of clarithromycin resistant strains

The genomic DNA isolated was PCR amplified by using the primer set for the amplification of 23S rRNA gene of H. pylori [Figure 1]. The restriction fragment length polymorphism (RFLP) analysis was performed for 46 samples, and no restriction site was observed for BbsI, but one strain of H. pylori showed the restriction site for BbsI [Figure 2] indicating that only 2.1% (1/46) of the strains were resistant for CLR. The PCR RFLP detects the mutation only at A2142G and A2143G positions. However, other mutation present at T2182C in two of our strains could not be detected by PCR RFLP alone. The PCR product of 24 samples selected randomly for sequencing was purified and sequenced for the detection of point mutation at various positions. A strong correlation was observed only for mutation at 2143 positions between the RFLP technique and sequence analysis of 23S rRNA gene. All the sequences have been recently submitted to Gen Bank.
Figure 1: DNA amplification of 617bp of 23S rRNA gene of Helicobacter pylori strains. Lane 1 – positive control, 26695 Lane 2 – 10 - Helicobacter pylori clinical isolates and Lane M - Marker (100 bp)

Click here to view
Figure 2: Polymerase chain reaction restriction fragment length polymorphism analysis of Clarithromycin resistant and Clarithromycin sensitive Helicobacter pylori strains. A2143G mutations were confirmed by BsaI-mediated restriction digestion in clarithromycin-resistant strains. The presence of the A2143G mutation created an additional BsaI restriction site causing the appearance of three smaller products of 103, 205 and 316 bps Lane M, DNA marker (100 bp ladder); lane 1, clarithromycin-sensitive strain 26695; lanes 2 clarithromycin-resistant strains conforming the point mutation at 2143 position of 23S rRNA gene

Click here to view


Screening of clarithromycin resistant strains by direct sequencing method

The sequences were aligned for mutation analysis with the GenBank accession number U27270 in CLUSTAL OMEGA. None of the strains of North-East India had mutation at 2142 position. Only one strain showed mutation at 2143 positions confirmed by RFLP and mutation analysis, and only 4.3% (2/46) strains had mutation at T to C at 2182 position [Figure 3].
Figure 3: Multiple sequence alignment of domain V of 23S rRNA gene of clarithromycin of Helicobacter pylori strains. The strain numbers are indicated on the left-hand side of each sequence. U27270 is a representative sequence showing A to G point mutations marked in bold at positions 2143 and T to C mutation at position 2182 of 23S rRNA genes. Numbering of nucleotide position followed the proposed system by Taylor et al.[8] (position [2515 373] +1 = position 2143)

Click here to view


Phylogenetic analysis of the partial sequence of 23S rRNA gene

The phylogenetic tree was reconstructed using the partial sequence of 23S rRNA gene depicts that during evolution and speciation event some strains of H. pylori bifurcated from each other. However, due to resemblance in sequences, they clustered in the same group [Figure 4]. Red cluster contains GMC strains (Gauhati Medical College strains collected from the GI diseased patients) which is separated from Nepal strain and subdivided into two cluster showing resemblance with this strain. However, another cluster divided into three clusters with country-wise grouping. Green cluster contains high variability with GMC48, GMC220 and other countries sequences. Purple cluster has GMC207, GMC184, GMC190 and Asian strains. Blue cluster has GMC, Australian and European strains along with the Reference sequence (Accession no. U27270). This may be due to horizontal gene transfer among the various strains.[16],[17]
Figure 4: 23S rRNA gene tree of Helicobacter pylori strain. Phylogenetic tree reconstructed by using ML method and TN93 model of nucleotide substitution (PhyML program used for tree reconstruction). Partial sequences of 23S rRNA is used in tree reconstruction. Tree consists of 37 different Helicobacter pylori strains. North-East India (GMC strains), Africa (South Africa (SA7) and Gambia), Asia (Russia, Nepal, Karachi, Japan and Bangladesh), Europe (Lithuania, Switzerland, Germany), South America (Peru [SHI and SAT]), Australia and Reference sequence (U27270)

Click here to view


Most of the GMC strains grouped together in a single clade (red colour) showing similarity among the sequences, which shows that they are different from other countries' strains. This clade further divided into two clusters that indicate there were two subtypes of GMC strains. Sequences from different countries and continents were widely distributed green, purple and blue clades. In green clade, GMC48 is monophyletic with Bangladesh strain (BD). This may be due to the closeness of both the geographical regions. Africa strains (South Africa7 and GAMBIA) and South America (SHI and SAT) strain from Peru are monophyletic. This supports that both the strains from different geographical regions clustered together and had common origin.[18] GMC220 and LITHUANIA appeared as an outgroup (last common ancestors) this green clade. Japanese strains (JAPAN) shows similarity to Africa strains and American strains. In purple clade, Russian strain (RUS) monophyletic to GMC190. Two GMC strains (GMC184 and GMC207) also shares some similarity with these strains. This shows similarity of Russian strain with GMC strain. Karachi strain (KARACHI) and Russian strain in this cluster show that GMC, Karachi and Russian strains had common origin. The clustering of strains from Germany, Switzerland and Australia appeared in a clade (blue colour). German strain was monophyletic to GMC167 strain and similarly Australian strain (AUS) and Reference sequence (U27270) was monophyletic. This may be due to bacterial mobility or migration of patients from one region to others.[19] The North-East Indian strains clustered differently and this may be one of the reasons for their different resistant patterns for CLR.

Screening of levofloxacin resistant strains by direct sequencing technique

The H. pylori-positive genomic DNA were PCR amplified by using the primer set for the amplification of gyraseA gene [Figure 5]. The PCR product was further purified and 46 strains were available for sequencing and sequence analysis. All the sequences have been recently submitted to the Gen Bank. The nucleotide sequences of gyraseA gene were translated by EXPASY TRANSLATE TOOL to predicted protein sequence and all the translated sequences were align for the mutation analysis with the reference sequence (HP0701) to detect the mutation at various positions [Figure 6].
Figure 5: DNA amplification of 428 bp of gyraseA gene of Helicobacter pylori strains. Lane 1 - positive control, 26695 Lane 2 – 9 - Helicobacter pylori clinical isolates and Lane M - Marker (100 bp)

Click here to view
Figure 6: Multiple sequence alignment of gyraseA gene of Helicobacter pylori strains for levofloxacin resistance. The strain number is indicated on the left-hand side of each sequence. HP0701 is a representative sequence showing N to K point mutations marked in bold at positions 87 and D to G/Y/N point mutation marked in bold at position 91 of the gyrase A gene of Helicobacter pylori

Click here to view


It has been seen that the strain of H. pylori which were selected for mutation analysis in gyraseA gene showed mutation at various positions, which reveal that 89.1% (41/46) strains of H. pylori isolated from North-East India were resistant towards LEV showing mutation at N to K at 87 position, A to V at 88 position and D to G/N/Y at 91 position.

Phylogenetic analysis of partial sequence of gyraseA gene

In gyraseA gene phylogeny [Figure 7], GMC strains clustered together in a single clade and other strains of H. pylori from different countries clustered in the different clades. GMC clade further divided into two sub-groups (shown in blue and red colour). The reference sequence (HP0701), sequences from different countries and few GMC strains clustered together (green clade). This pattern of clustering shows that GMC strains had common origin and resemblance to each other. GMC256 was monophyletic to Peru strains (Sat464 and SHI417) which might be due to high similarity between these strains. Within the green cluster, strains from Germany (GER), Australia (AUS) and Switzerland (SWZ) cluster with GMC97 strain. GAMBIA and HP0701 had similarities with each other and had common origin to European and Australian strains. Lithuania, South Africa, Japan and Russian strains show similarity to South American strains. Lower red colour clade of GMC strains show similarity with green clade, but due to high resemblance with own GMC strains, they cluster with GMC strain not with strains of different countries. Phylogenetic tree of gyraseA gene shows similarity of GMC256 with Asian, African, European and South American strains and GMC97 with European and African strains showing common origin or horizontal gene transfer between strains of different countries and GMC strains.[19] However, most of the GMC strains clustered with each other, which shows that they are different strains from other countries and it may be the reason that their resistance pattern is also different from other counties.
Figure 7: GyraseA gene tree of Helicobacter pylori strains. Phylogenetic tree was reconstructed by using ML method and TN93 model of nucleotide substitution (PhyML program used for tree reconstruction). Partial sequences of gyraseA gene is used for tree construction. Tree consists of 57 different Helicobacter pylori strains from North-East India (GMC strains), Africa (South Africa (SA7) and Gambia), Asia (Russia and Japan), Europe (Lithuania, Switzerland, Germany), South America (Peru [SHI417 and Sat464]), Australia, and Reference sequence (Accession no. HP0701)

Click here to view


Correlation between antibiotic resistance and clinical information

The distribution of CLR and LEV resistance according to gender, age and disease outcome is shown in [Table 1]. There was a nonsignificant association for CLR and LEV resistance with gender, age and clinical outcome (P > 0.05). Although the resistance to LEV was higher as compared to CLR in patients with Duodenitis and Deformed Duodenum, Gastric Ulcer, Normal (100%) than patients with Gastric Erosion (85.7%), but these differences were not significant (P > 0.05) [Table 1].
Table 1: Correlation of clarithromycin and levofloxacin resistance of 46 Helicobacter pylori isolates of North East India according to their clinical information

Click here to view



 ~ Discussion Top


H. pylori infection is transmissible which causes various GI diseases which are a major public health problem for which treatment with the combination of antibiotics should be provided when it is diagnosed. The resistance towards many antibiotics is the major cause of treatment failure so; there should be a continuous search for improved eradication therapy to cure H. pylori infection.[5] The resistance to antibiotics shows controversial findings even in the same geographical area which may reduce the therapeutic outcome. Thus, the resistance towards the most commonly used antibiotics for the eradication of H. pylori may provide a guideline for all the clinicians.[10]

In our study, we studied the prevalence of CLR and LEV resistance by mutation analysis of 23S rRNA gene and gyraseA gene, respectively, which may be associated within vitro resistance in H. pylori. We observed that only 6.5% of North-East Indian strains were resistant for CLR which is different from the reported rate of CLR resistance throughout India between 11-96% (except for Kolkata showing 0% resistance[9]), namely Lucknow (4%),[9] Delhi, NCR (11.8%),[15] Mumbai (91%),[9] Gujarat (58.8%)[9] and Hyderabad (96%).[9] CLR resistance is also very high and varies significantly in other countries, namely Pakistan (5.4%),[20] North America (30.8%), Portuguese (42.3%), Japan (15.2-86.4%), China (12.8-23.8%), Spain (35.6), USA (10-15%),[21] Bangladesh (18%), Nepal (21%), Taiwan (11%) and Vietnam (34%).[21] The higher resistance towards CLR observed in developing countries maybe because of the usage of this antibiotic in the treatment of dental infection, to treat the upper respiratory tract and for the treatment of communicable diseases, which is very prevalent. In general, research has been focussed on the resistance pattern of macrolide antibiotic CLR resistance in H. pylori due to the substitution mutation in peptidyl transferase of 23S rRNA gene at A2142G and A2143G.[22] The studies from Japan, Delhi NCR, Colombia and Europe have reported that the CLR resistance is associated with point mutation at various positions of H. pylori strains. Hence, from our present study, we can suggest that the first-line therapy comprising PPI, CLR, MTZ or AMX may be the best and effective for the eradication of H. pylori form the North East Indian patients.

When the resistance rate for the first-line therapy (CLR and MTZ or AMX) is higher than 15-20%, then the other drug of choice, i.e., LEV is given for the eradication process of H. pylori infection in many countries.[23] However, in our present study, we have also done the antibiogram profiling for LEV where we have found that 89.1% of the H. pylori strains of North East India are resistant for LEV which is almost similar to our previous study of North India with 73.2%[24] which much higher than reports from Gujarat (13.8%)[9] and other countries such as Pakistan (16.2%),[20] France (15%), Germany (22%), Taiwan (12%), South Korea,[21] Shanghai (3.6%), Beijing (29.1%),[17] Bangladesh (66%), Nepal (43%), Taiwan (11%), Turkey (28%) and Vietnam (25%).[21] The resistance for LEV was observed due to the point mutation at the amino acid position of gyrase A gene of H. pylori, N to K at 87 position, A to V at 88 position and D to G/N/Y at 91 position.[15] Various studies from Karachi, Australia, Gujarat, Delhi NCR have also reported the association of resistance with the point mutation at various positions of H. pylori strain. As the resistance rate of LEV is very high in North East Indian strain (89.1%), it indicates that LEV is not suitable as second-line therapy according to the recommended guidelines because it is not the best choice of treatment if the resistance rate is more than 20% and the clinician has to choose the other alternatives for the treatment regime.

The evolutionary relationship of the 23S rRNA gene and gyraseB gene sequence data are significantly reliable for identification and phylogenetic analysis of H. pylori, primarily because of three-fold higher number of informative bases.[11] The phylogenetic analysis is done by PhyML software using T93 model[14] for 23S rRNA gene and gyraseA gene of H. pylori. Our analysis depicted that the North-East Indian strains fall in a different cluster, which may be the reason that they belong from different ethnic groups living in distinct geographical areas.

Antimicrobial susceptibility testing is the best and effective method which tells the antibiotic resistance pattern geographically and which helps the clinicians to treat the infection with the best response to therapy. It is worth noting that although the CLR resistance is high in other parts of India, we found that only 6.5% of the North-East Indian H. pylori stains were resistant to CLR, however more than 89.1% of the strains is resistance towards LEV and they also fall in different cluster in the phylogenetic tree. Hence, based on our result of CLR and LEV resistance pattern and their mechanism of action we can suggest that the CLR stands as a drug of choice in the line of treatment of H. pylori eradication in North-East Indian patients suffering from H. pylori infection.


 ~ Conclusions Top


Our findings state that CLR sensitivity is very high among North-East Indian strains, and therefore, the eradication may be possible with the use of CLR, but LEV is ineffective due to its high resistance rate. We also observed that the H. pylori strains from North-East India form a different cluster based on the partial sequence of 23S rRNA and gyraseA gene.

Acknowledgement

We thank Amity University for providing the infrastructure and support to carry out the work. AS gratefully acknowledge the DBT, India, for providing financial support.

Financial support and sponsorship

The study was supported by the Department of Biotechnology (DBT) under grant No.(BT/240/NE/TBP/2011).

Conflicts of interest

There are no conflicts of inerest.



 
 ~ References Top

1.
Marshall BJ. The 1995 albert lasker medical research award. Helicobacter pylori. The etiologic agent for peptic ulcer. JAMA 1995;274:1064-6.  Back to cited text no. 1
    
2.
Go MF, Crowe SE. Virulence and pathogenicity of Helicobacter pylori. Gastroenterol Clin North Am 2000;29:649-70.  Back to cited text no. 2
    
3.
Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, et al. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 1991;325:1127-31.  Back to cited text no. 3
    
4.
Datta S, Chattopadhyay S, Balakrish Nair G, Mukhopadhyay AK, Hembram J, Berg DE, et al. Virulence genes and neutral DNA markers of Helicobacter pylori isolates from different ethnic communities of West Bengal, India. J Clin Microbiol 2003;41:3737-43.  Back to cited text no. 4
    
5.
Graham DY. Antibiotic resistance in Helicobacter pylori: Implications for therapy. Gastroenterology 1998;115:1272-7.  Back to cited text no. 5
    
6.
Nahar S, Mukhopadhyay AK, Khan R, Ahmad MM, Datta S, Chattopadhyay S, et al. Antimicrobial susceptibility of Helicobacter pylori strains isolated in Bangladesh. J Clin Microbiol 2004;42:4856-8.  Back to cited text no. 6
    
7.
Garrido L, Toledo H. Novel genotypes in Helicobacter pylori involving domain V of the 23S rRNA gene. Helicobacter 2007;12:505-9.  Back to cited text no. 7
    
8.
Taylor DE, Ge Z, Purych D, Lo T, Hiratsuka K. Cloning and sequence analysis of two copies of a 23S rRNA gene from Helicobacter pylori and association of clarithromycin resistance with 23S rRNA mutations. Antimicrob Agents Chemother 1997;41:2621-8.  Back to cited text no. 8
    
9.
Gehlot V, Mahant S, Mukhopadhyay AK, Das K, De R, Kar P, et al. Antimicrobial susceptibility profiles of Helicobacter pylori isolated from patients in North India. J Glob Antimicrob Resist 2016;5:51-6.  Back to cited text no. 9
    
10.
Boyanova L, Mitov I. Geographic map and evolution of primary Helicobacter pylori resistance to antibacterial agents. Expert Rev Anti Infect Ther 2010;8:59-70.  Back to cited text no. 10
    
11.
Hannula M, Hänninen ML. Phylogenetic analysis of Helicobacter species based on partial gyrB gene sequences. Int J Syst Evol Microbiol 2007;57:444-9.  Back to cited text no. 11
    
12.
European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 3.1. European Committee on Antimicrobial Susceptibility Testing; 2013.  Back to cited text no. 12
    
13.
Chattopadhyay S, Patra R, Ramamurthy T, Chowdhury A, Santra A, Dhali GK. Multiplex PCR assay for rapid detection and genotyping of Helicobacter pylori directly from biopsy specimens. J Clin Microbiol 2004;42:2821-4.  Back to cited text no. 13
    
14.
Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 2003;52:696-704.  Back to cited text no. 14
    
15.
Gehlot V, Mahant S, Mukhopadhyay AK, Das K, Alam J, Ghosh P, et al. Low prevalence of clarithromycin-resistant Helicobacter pylori isolates with A2143G point mutation in the 23S rRNA gene in north india. J Glob Antimicrob Resist 2016;6:39-43.  Back to cited text no. 15
    
16.
Niehus R, Mitri S, Fletcher AG, Foster KR. Migration and horizontal gene transfer divide microbial genomes into multiple niches. Nat Commun 2015;6:8924.  Back to cited text no. 16
    
17.
Som A. Causes, consequences and solutions of phylogenetic incongruence. Brief Bioinform 2015;16:536-48.  Back to cited text no. 17
    
18.
Correa P, Piazuelo MB. Evolutionary history of the Helicobacter pylori genome: Implications for gastric carcinogenesis. Gut Liver 2012;6:21-8.  Back to cited text no. 18
    
19.
Linz B, Balloux F, Moodley Y, Manica A, Liu H, Roumagnac P, et al. An african origin for the intimate association between humans and Helicobacter pylori. Nature 2007;445:915-8.  Back to cited text no. 19
    
20.
Rasheed F, Campbell BJ, Alfizah H, Varro A, Zahra R, Yamaoka Y, et al. Analysis of clinical isolates of Helicobacter pylori in Pakistan reveals high degrees of pathogenicity and high frequencies of antibiotic resistance. Helicobacter 2014;19:387-99.  Back to cited text no. 20
    
21.
Kuo YT, Liou JM, El-Omar EM, Wu JY, Leow AHR, Goh KL, et al. Primary antibiotic resistance in Helicobacter pylori in the Asia-Pacific region: A systematic review and meta-analysis. Lancet Gastroenterol Hepatol 2017;2:707-15.  Back to cited text no. 21
    
22.
Miftahussurur M, Yamaoka Y. Appropriate first-line regimens to combat Helicobacter pylori antibiotic resistance: An Asian perspective. Molecules 2015;20:6068-92.  Back to cited text no. 22
    
23.
Malfertheiner P, Megraud F, O'Morain CA, Atherton J, Axon AT, Bazzoli F, et al. Management of Helicobacter pylori infection – The maastricht IV/florence consensus report. Gut 2012;61:646-64.  Back to cited text no. 23
    
24.
Gehlot V, Mahant S, Das R. Most of the Helicobacter pylori isolates are resistant to levofloxacin in North India. Int J Phar Pharm Sci 2016;8:454-6.  Back to cited text no. 24
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04