Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1472 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (380 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed607    
    Printed1    
    Emailed0    
    PDF Downloaded48    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 37  |  Issue : 1  |  Page : 24-28
 

Institutional outbreak of varicella in a child welfare institute in Chandigarh, North India


1 Department of Virology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India
2 Department of Paediatrics, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India

Date of Web Publication16-Aug-2019

Correspondence Address:
Dr. Mini P Singh
Department of Virology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh - 160 012
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_18_264

Rights and Permissions

 ~ Abstract 


Introduction: Varicella outbreaks are known to occur in developing nations as vaccine coverage is still low. Material and Methods: In the present study, an institutional outbreak from Chandigarh, India, is reported wherein the utility of non-invasive samples such as saliva and urine was studied for the molecular diagnosis of varicella by conventional polymerase chain reaction (PCR), real-time PCR and real-time loop-mediated isothermal amplification (real-time LAMP). Results: The results of the present study showed that saliva and urine samples can be used for outbreak investigation of varicella compared to varicella-zoster virus DNA in vesicular swab samples with reasonable sensitivity. Conclusion: Thus, molecular techniques may be useful in the early identification of the outbreak and timely isolation, and the treatment of cases can further prevent its spread.


Keywords: Loop-mediated isothermal amplification, polymerase chain reaction, varicella


How to cite this article:
Singh MP, Rungta T, Kumar A, Goyal K, Bharti B, Ratho R K. Institutional outbreak of varicella in a child welfare institute in Chandigarh, North India. Indian J Med Microbiol 2019;37:24-8

How to cite this URL:
Singh MP, Rungta T, Kumar A, Goyal K, Bharti B, Ratho R K. Institutional outbreak of varicella in a child welfare institute in Chandigarh, North India. Indian J Med Microbiol [serial online] 2019 [cited 2019 Oct 21];37:24-8. Available from: http://www.ijmm.org/text.asp?2019/37/1/24/264477





 ~ Introduction Top


Varicella-zoster virus (VZV) is a DNA virus belonging to family Herpesviridae, is responsible for causing varicella (chickenpox), a highly contagious disease. It is an infection mainly of childhood and the virus is transmitted in aerosols or by direct person-to-person contact of vesicular fluid. The virus after getting transmitted to susceptible individual by inhalation route replicates in the nasopharynx, spreading thereafter to cause the centripetal rash that is characteristic of chickenpox.[1]

Clinically, primary varicella infection generally manifest as fever, malaise and vesicular rash that primarily involves the trunk and face.[2] The symptoms usually resolve within 7–10 days, but in rare cases, it can cause complications by involving other organs.[3] However, with the introduction of childhood varicella vaccination, rates of hospitalisation and mortality have decreased substantially.[4],[5]

In temperate climate, 13–16 cases of varicella per 1000 people are reported with the highest incidence being in children.[2] However, in tropical climate like India, the incidence is higher in adults. The incubation period after exposure to the disease is 14–16 days with a high secondary attack rate of more than 85%.[6]

The present study reports varicella outbreak in a child care institution (Snehalaya) in Chandigarh, a union territory in North India. This is a setup in Maloya for the young children who live or work on the streets as labourers or work as porters at railway stations or bus terminals to earn their livelihood. This setup aims to bring the above children to the mainstream of life and rehabilitate them. The outbreaks of chickenpox in institutions, schools and barracks can spread fast owing to a high secondary rate of up to 90%.[7],[8]

The present study was carried out while investigating a suspected outbreak of varicella by using molecular methods (conventional polymerase chain reaction [PCR], real-time PCR and real-time loop-mediated isothermal amplification real-time LAMP) on vesicular samples. Furthermore, the utility of testing other noninvasive samples such as saliva and urine for varicella outbreak investigation was also assessed.


 ~ Materials and Methods Top


Outbreak setting

An outbreak of fever with rash was reported by social paediatricians in Snehalaya, in June 2016, where children of both the gender reside in different blocks. This information was given by the social paediatrics department of the institute who routinely visit this centre and provide care to these children. In total, 15 clinically suspected cases were identified after active surveillance of the affected area.

Sample collection

The 15 cases and 29 age-matched healthy children residing in the same orphanage (healthy controls) were enrolled after obtaining written informed consent. The blood samples were collected. Serum was separated and used for serological testing. The vesicular swabs, urine and saliva were also collected from the cases showing the presence of active lesions. All the samples were collected within 5 days of onset of rash. The vesicular swab was collected by puncturing and aspirating the fluid from vesicle and vigorously rubbing the base of the lesion. These swabs were then put in 2 ml viral transport media and transported in the cold chain. Due to an outbreak situation, the ethical clearance could not be obtained at the time of sample collection. The ethical approval was then obtained retrospectively by the PGIMER, Chandigarh Institute Ethics Committee as per the National guidelines.

Serology

Serum was separated from the blood samples and stored at −20°C till tested. The VZV IgM antibodies were detected in both patients and controls by using commercially available enzyme-linked immunosorbent assay (ELISA) kit (Demeditec diagnostics, Germany) as per the manufacturer's instructions.

Polymerase chain reaction

The DNA was extracted from the various samples including vesicular swab, saliva and urine using the commercially available kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The DNA was finally eluted in 40 μl of elution buffer. The conventional PCR of VZV was performed by amplifying open reading frame (ORF) 28 gene of VZV as described previously.[9] The PCR was performed in 20 μl reaction volume containing 5 μl of DNA. The reaction mixture consisted of 1X PCR Buffer, 3 mM MgCl2, 200 μM dNTP, 0.5 U of Taq polymerase and 1 μM of each primer (Genei, India). The thermocycler conditions were 94°C for 3 min, followed by 39 cycles at 94°C for 30 s, 55°C for 30 s and 72°C for 45 s and a final extension at 72°C for 3 min. The amplicons of 355 bp of VZV were visualised by gel electrophoresis using 2% agarose gel followed by ethidium bromide staining. All the precautions were taken during the run which included putting up of negative and positive controls in each run along with samples. Filtered tips were used while preparing master mix and reaction mixture was made in the laminar hood to prevent contamination. All the steps of DNA extraction, master mix preparation and amplification were carried out in physically separate areas to prevent cross-contamination. The limit of detection for conventional PCR assays was 8000 copies/μl.[10]

Real-time polymerase chain reaction

The TaqMan real-time PCR was performed as described previously.[11] The TaqMan PCR reaction was performed in 20 μl volume reaction containing 4 μl of DNA, 500 nM of each primer (Forward = 5'CCATCCGATTATGCCACCTTTACAG3'; Reverse = 5'TCGAACGTTAGAGCGCACAA3) and 250 nM of NED-labelled probe (5'TTGGAGGAAAACGTCTTTTTT3') targeting ORF 28 region. Amplification and detection were performed using applied biosystems real-time PCR instrument (ABI 7500, USA). The conditions were 50°C for 2 min, 95°C for 10 s, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min.

For the absolute quantification of VZV DNA, the plasmid-containing VZV ORF 28 gene (DNA polymerase)[12] fragment was extracted using RBC HiYield plasmid mini kit (Real Biotech Corporation, Taiwan) as per the manufacturer's instruction. It was then 10-fold serially diluted to quantify DNA from unknown samples as copies/μl to check the LOD. The lower LOD of quantitative PCR was found to be five copies/μl with R2= 0.996 and slope = −3.186.

Real-time loop-mediated isothermal amplification

Real-time LAMP was performed using six primers for the LAMP assay as described previously by Kaneko et al,[13] including two outer primers (F3 and B3), a forward inner primer (FIP), a backward inner primer (BIP) and two loop primers (LPF and BPF). The real-time LAMP was performed using 12.5 μl reaction mixture, 1.6 μM concentration of each inner primer (FIP and BIP), 0.2 μM concentration of each outer primer (F3 and B3), 0.8 μM concentration of each loop primer (LPF and BPF) and 1 μl of DNA sample. The reaction mixture was incubated at 65°C for 45 min and then heated to 80°C for 2 min to terminate the reaction in a real-time LAMP (Genie II, OptiGene, United Kingdom).

Statistics

The Spearman's correlation coefficient was used to check the relationship between the viral load in the vesicular swab, urine and saliva samples. The value of P < 0.05 was considered statistically significant. The SPSS version 22.0 (IBM Corporation, New York, USA) was used for the statistical calculation.


 ~ Results Top


Demographic characteristics

The outbreak affected male children in the age group of 8–13 years (mean age 9 years ± 4.1). In a total of 15 confirmed cases of varicella were reported.

Clinical features

The presence of rash (100%) was the most common clinical manifestation observed which was generalized in all the cases and the majority (73%) of children had 50–250 vesicular lesions. The lesions were predominantly present on the face, whereas a few children also had lesions on the abdomen, trunk and head. None of the cases was hospitalised, and none of them reported any complications. Acyclovir treatment was given to 10 (66.6%) children.

Varicella antibody detection

Of the 15 suspected cases, VZV IgM antibodies were detected only in 3 (20%) children. The VZV IgM antibodies were also detected in two asymptomatic controls.

Varicella polymerase chain reaction

The varicella DNA could be detected by conventional PCR in 100% vesicular swabs (14/14), 69.2% saliva samples (9/13) and 66.6% urine samples (10/15). The positivity by real-time PCR was 100% (14/14) in swab, 84% (11/13) in saliva and 80% (12/15) in urine. The mean viral load in the vesicular swab, saliva and urine samples was 1.8 × 105 copies/μl, 4.8 × 103 copies/μl and 2.4 × 103 copies/μl, respectively. The detailed serological and molecular profile of these 15 patients is described in [Table 1].
Table 1: Results of serological and molecular investigations in various clinical samples

Click here to view


Varicella-zoster virus real-time loop-mediated isothermal amplification

The Real-time LAMP showed 100% positivity (14/14) in the vesicular swab, 77.7% (7/9) in saliva and 100% (10/10) in urine. The mean viral load in the vesicular swab, saliva and urine samples was 1.6 × 106 copies/μl, 2.5 × 105 copies/μl and 4.1 × 104 copies/μl, respectively. The overall correlation coefficient between real-time PCR and real-time LAMP was found to be 0.67 (P < 0.0001) [Figure 1].
Figure 1: Correlation between real time polymerase chain reaction and real time loop-mediated isothermal amplification in three different samples i.e., vesicular swab, saliva and urine (R2 = 0.67)

Click here to view



 ~ Discussion Top


Chickenpox outbreaks are common in India since the varicella vaccine is not included in the universal immunisation schedule for India. Furthermore, a low seroprevalence of varicella antibodies has been reported among Indian children.[9],[14],[15],[16] The outbreaks are common in day-care settings where children are in close contact with each other leading to increased transmission among peer groups.[17],[18] In the present study, an institutional outbreak from Chandigarh is reported, wherein the utility of noninvasive samples such as saliva and urine was studied for the diagnosis of varicella.

The various diagnostic modalities available for chickenpox can be categorised into direct and indirect laboratory methods.[19],[20],[21] The direct demonstration of inclusion bodies by Tzanck smear is a cheap alternative but has low sensitivity.[22],[23],[24] Detection of virus antigen by immunofluorescence is another alternative method, but it requires expertise and immunofluorescence microscope, which is costly.[25],[26] Among the direct methods, the virus isolation was considered as the gold standard,[27] but it is time consuming, tedious and has low sensitivity.[28] These days detection of VZV DNA in clinical samples by PCR has replaced virus isolation as a gold standard due to its high sensitivity and specificity.[29],[30] The conventional diagnosis of varicella rests on the detection of IgM antibodies by ELISA which take time to develop.[10],[31] In the present study, VZV DNA was detected by molecular methods for the early diagnosis of the outbreak.

In this study, VZV IgM antibodies were detected only in 20% (3/15) cases possibly due to the reason that duration of rash was <5 days in the majority of the cases and antibodies take time to develop. IgM positivity among the control group was found to be 6.9% (2/29), and these were asymptomatic initially but on follow-up, they were found to develop the disease. Among control group, only blood samples were collected.

In the present study, a higher positivity (100%) was obtained in vesicular swab samples by all the three molecular techniques used. Previous studies have shown that PCR was able to confirm the clinical diagnosis in 87%–100% of cases in vesicular swabs by PCR.[32],[33],[34] The rash was generalised and the majority of the children had 50–250 vesicular lesions. Swabs were collected randomly from the most easily accessible vesicular lesion, and all were found to be positive for VZV DNA. The clinical utility of LAMP assay for the diagnosis of varicella in vesicular swabs has been evaluated by Kobayashi et al.[35] and authors found LAMP to be 100% sensitive. The highest mean viral load was found in vesicular swab followed by saliva and urine samples by real-time PCR as well as real-time LAMP. Viral load estimation is important in predicting the severity of illness and can be used to monitor the response to antiviral treatment. In the present study, 66.6% of the children received acyclovir treatment and responded well without any sequel. However, a limitation of the study was that follow-up samples were not collected after the resolution of clinical signs and symptoms to document the decrease in viral load. Kimura et al.[36] et al have shown the high occurrence of viraemic VZV DNA in varicella than in zoster and showed that acyclovir treatment resulted in marked suppression of viraemia in varicella. Although the vesicular samples had high sensitivity, the fear of needle during vesicular aspiration may preclude its use. Hence, the utility of non-invasive samples including saliva and urine for outbreak investigation was also ascertained, which may be useful when the vesicular lesions have healed, thereby dropping the sensitivity of PCR.[37],[38] The positivity of VZV DNA among saliva samples was found to be the highest by real-time PCR (84%) followed by real-time LAMP (77.7%) and conventional PCR (69.2%). Watanabe et al.[38] also reported a similar sensitivity of 87.1% for PCR using saliva samples for the diagnosis of varicella in children. Among the urine samples, the highest positivity of VZV DNA was detected by real-time LAMP (100%) followed by real-time PCR (80%) and conventional PCR (66.6%). Furthermore, serial viral load estimation in saliva/urine may be used as non-invasive method for seeing the response to therapy among complicated cases of VZV infection among adults and immunocompromised. The correlation between real-time PCR and real-time LAMP was found to be moderate in this study and their sensitivity was more than conventional PCR. The limitation of real-time assays is the high cost of the reagents and its limited availability in resource-poor settings. In the present study, since the viral load was quantified; hence, real-time LAMP was performed. However, the conventional LAMP PCR is cheaper, can be done in a water bath and hence useful in resource limited outbreak setting where it can be used as a point of care test[34],[39] and can provide results in 30–45 min only. LAMP has also been evaluated for the detection of other viruses such as herpes simplex virus, cytomegalovirus, Epstein–Barr virus, dengue, Zika and Ebola virus.[35],[40],[41],[42],[43],[44],[45],[46],[47]


 ~ Conclusion Top


The molecular techniques may be useful in the prompt diagnosis of the outbreak and can prevent its spread by the timely isolation and treatment of cases. The saliva and urine samples can be used for outbreak investigation of varicella with reasonable sensitivity. The varicella vaccine should be considered for routine immunisation in India to prevent these outbreaks.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Arvin AM. Varicella-zoster virus. Clin Microbiol Rev 1996;9:361-81.  Back to cited text no. 1
    
2.
Heininger U, Seward JF. Varicella. Lancet 2006;368:1365-76.  Back to cited text no. 2
    
3.
Guess HA, Broughton DD, Melton LJ 3rd, Kurland LT. Population-based studies of varicella complications. Pediatrics 1986;78:723-7.  Back to cited text no. 3
    
4.
Nguyen HQ, Jumaan AO, Seward JF. Decline in mortality due to varicella after implementation of varicella vaccination in the United States. N Engl J Med 2005;352:450-8.  Back to cited text no. 4
    
5.
Davis MM, Patel MS, Gebremariam A. Decline in varicella-related hospitalizations and expenditures for children and adults after introduction of varicella vaccine in the United States. Pediatrics 2004;114:786-92.  Back to cited text no. 5
    
6.
Gabutti G, Franchi M, Maniscalco L, Stefanati A. Varicella-zoster virus: Pathogenesis, incidence patterns and vaccination programs. Minerva Pediatr 2016;68:213-25.  Back to cited text no. 6
    
7.
Shrivastava SR, Shrivastava PS, Ramasamy J. Epidemiological investigation of a case of chickenpox in a medical college in Kancheepuram, India. Germs 2013;3:18-20.  Back to cited text no. 7
    
8.
Shimakawa Y, Camélique O, Ariyoshi K. Outbreak of chickenpox in a refugee camp of Northern Thailand. Confl Health 2010;4:4.  Back to cited text no. 8
    
9.
Singh MP, Chandran C, Sarwa A, Kumar A, Gupta M, Raj A, et al. Outbreak of chickenpox in a union territory of North India. Indian J Med Microbiol 2015;33:524-7.  Back to cited text no. 9
[PUBMED]  [Full text]  
10.
Kumar A, Singh MP, Bansal R, Gupta A, Ram J, Ratho RK. Development and evaluation of multiplex real-time PCR for diagnosis of HSV-1, VZV, CMV, and Toxoplasma gondii in patients with infectious uveitis. Diagn Microbiol Infect Dis 2017;89:191-6.  Back to cited text no. 10
    
11.
Singh MP, Kaur R, Kumar A, Gupta M, Garg S, Ratho RK. Investigation of an outbreak of varicella in Chandigarh, North India, using a real-time polymerase chain reaction approach. Indian J Med Microbiol 2017;35:417-20.  Back to cited text no. 11
[PUBMED]  [Full text]  
12.
Yang M, Hay J, Ruyechan WT. The DNA element controlling expression of the varicella-zoster virus open reading frame 28 and 29 genes consists of two divergent unidirectional promoters which have a common USF site. J Virol 2004;78:10939-52.  Back to cited text no. 12
    
13.
Kaneko H, Iida T, Aoki K, Ohno S, Suzutani T. Sensitive and rapid detection of herpes simplex virus and varicella-zoster virus DNA by loop-mediated isothermal amplification. J Clin Microbiol 2005;43:3290-6.  Back to cited text no. 13
    
14.
Singh MP, Singh G, Kumar A, Singh A, Ratho RK. Epidemiologic lessons: Chickenpox outbreak investigation in a rural community around Chandigarh, North India. Indian J Pathol Microbiol 2011;54:772-4.  Back to cited text no. 14
[PUBMED]  [Full text]  
15.
Lokeshwar MR, Agrawal A, Subbarao SD, Chakraborty MS, Ram Prasad AV, Weil J, et al. Age related seroprevalence of antibodies to varicella in India. Indian Pediatr 2000;37:714-9.  Back to cited text no. 15
    
16.
Balraj V, John TJ. An epidemic of varicella in rural Southern India. J Trop Med Hyg 1994;97:113-6.  Back to cited text no. 16
    
17.
Brunell PA. Transmission of chickenpox in a school setting prior to the observed exanthem. Am J Dis Child 1989;143:1451-2.  Back to cited text no. 17
    
18.
Gustafson TL, Lavely GB, Brawner ER Jr., Hutcheson RH Jr., Wright PF, Schaffner W. An outbreak of airborne nosocomial varicella. Pediatrics 1982;70:550-6.  Back to cited text no. 18
    
19.
Leung J, Harpaz R, Baughman AL, Heath K, Loparev V, Vázquez M, et al. Evaluation of laboratory methods for diagnosis of varicella. Clin Infect Dis 2010;51:23-32.  Back to cited text no. 19
    
20.
Stoopler ET, Pinto A, DeRossi SS, Sollecito TP. Herpes simplex and varicella-zoster infections: Clinical and laboratory diagnosis. Gen Dent 2003;51:281-6.  Back to cited text no. 20
    
21.
Kurtis B. Laboratory diagnosis of cutaneous herpes simplex and varicella – Zoster infections. Trans St Johns Hosp Dermatol Soc 1975;61:35-43.  Back to cited text no. 21
    
22.
Ozcan A, Senol M, Saglam H, Seyhan M, Durmaz R, Aktas E, et al. Comparison of the Tzanck test and polymerase chain reaction in the diagnosis of cutaneous herpes simplex and varicella zoster virus infections. Int J Dermatol 2007;46:1177-9.  Back to cited text no. 22
    
23.
Solomon AR, Rasmussen JE, Weiss JS. A comparison of the Tzanck smear and viral isolation in varicella and herpes zoster. Arch Dermatol 1986;122:282-5.  Back to cited text no. 23
    
24.
Solomon AR. The Tzanck smear. Viable and valuable in the diagnosis of herpes simplex, zoster, and varicella. Int J Dermatol 1986;25:169-70.  Back to cited text no. 24
    
25.
Coffin SE, Hodinka RL. Utility of direct immunofluorescence and virus culture for detection of varicella-zoster virus in skin lesions. J Clin Microbiol 1995;33:2792-5.  Back to cited text no. 25
    
26.
Sadick NS, Swenson PD, Kaufman RL, Kaplan MH. Comparison of detection of varicella-zoster virus by the Tzanck smear, direct immunofluorescence with a monoclonal antibody, and virus isolation. J Am Acad Dermatol 1987;17:64-9.  Back to cited text no. 26
    
27.
Ozaki T, Kajita Y, Namazue J, Yamanishi K. Isolation of varicella-zoster virus from vesicles in children with varicella. J Med Virol 1996;48:326-8.  Back to cited text no. 27
    
28.
Schmutzhard J, Merete Riedel H, Zweygberg Wirgart B, Grillner L. Detection of herpes simplex virus type 1, herpes simplex virus type 2 and varicella-zoster virus in skin lesions. Comparison of real-time PCR, nested PCR and virus isolation. J Clin Virol 2004;29:120-6.  Back to cited text no. 28
    
29.
Espy MJ, Teo R, Ross TK, Svien KA, Wold AD, Uhl JR, et al. Diagnosis of varicella-zoster virus infections in the clinical laboratory by LightCycler PCR. J Clin Microbiol 2000;38:3187-9.  Back to cited text no. 29
    
30.
Chickenpox (Varicella). Interpreting Laboratory Tests. Available from: https://www.cdc.gov/chickenpox/hcp/lab-tests.html. [Last assessed on 2017 Sept 10].  Back to cited text no. 30
    
31.
Oladepo DK, Klapper PE, Percival D, Vallely PJ. Serological diagnosis of varicella-zoster virus in sera with antibody-capture enzyme-linked immunosorbent assay of IgM. J Virol Methods 2000;84:169-73.  Back to cited text no. 31
    
32.
Sauerbrei A, Eichhorn U, Schacke M, Wutzler P. Laboratory diagnosis of herpes zoster. J Clin Virol 1999;14:31-6.  Back to cited text no. 32
    
33.
Beards G, Graham C, Pillay D. Investigation of vesicular rashes for HSV and VZV by PCR. J Med Virol 1998;54:155-7.  Back to cited text no. 33
    
34.
Okamoto S, Yoshikawa T, Ihira M, Suzuki K, Shimokata K, Nishiyama Y, et al. Rapid detection of varicella-zoster virus infection by a loop-mediated isothermal amplification method. J Med Virol 2004;74:677-82.  Back to cited text no. 34
    
35.
Kobayashi T, Yagami A, Suzuki K, Ihira M, Yoshikawa T, Matsunaga K. Clinical utility of loop-mediated isothermal amplification assay for the diagnosis of common alpha herpesvirus skin infections. J Dermatol 2013;40:1033-7.  Back to cited text no. 35
    
36.
Kimura H, Kido S, Ozaki T, Tanaka N, Ito Y, Williams RK, et al. Comparison of quantitations of viral load in varicella and zoster. J Clin Microbiol 2000;38:2447-9.  Back to cited text no. 36
    
37.
Goyal K, Ratho RK, Kanwar AJ, Mishra B, Singh MP. Role of polymerase chain reaction in detection of genital herpes. Indian J Dermatol Venereol Leprol 2013;79:705-6.  Back to cited text no. 37
[PUBMED]  [Full text]  
38.
Watanabe M, Ochiai H, Ito M, Negoro M, Suga S, Ihara T. Laboratory diagnosis of breakthrough varicella in children. Pediatr Infect Dis J 2017;36:560-3.  Back to cited text no. 38
    
39.
Goyal K, Kaur H, Sehgal A, Sehgal R. RealAmp loop-mediated isothermal amplification as a point-of-care test for diagnosis of malaria: Neither too close nor too far. J Infect Dis 2015;211:1686.  Back to cited text no. 39
    
40.
Liu X, Tang J, Wang M, Ma Q, Wang Y. Visual detection and evaluation of latent and lytic gene expression during Epstein-Barr virus infection using one-step reverse transcription loop-mediated isothermal amplification. Int J Mol Sci 2013;14:23922-40.  Back to cited text no. 40
    
41.
Reddy AK, Balne PK, Reddy RK, Mathai A, Kaur I. Loop-mediated isothermal amplification assay for the diagnosis of retinitis caused by herpes simplex virus-1. Clin Microbiol Infect 2011;17:210-3.  Back to cited text no. 41
    
42.
Suzuki R, Yoshikawa T, Ihira M, Enomoto Y, Inagaki S, Matsumoto K, et al. Development of the loop-mediated isothermal amplification method for rapid detection of cytomegalovirus DNA. J Virol Methods 2006;132:216-21.  Back to cited text no. 42
    
43.
Kurosaki Y, Martins DB, Kimura M, Catena AD, Borba MA, Mattos SD, et al. Development and evaluation of a rapid molecular diagnostic test for zika virus infection by reverse transcription loop-mediated isothermal amplification. Sci Rep 2017;7:13503.  Back to cited text no. 43
    
44.
Ge Y, Zhou Q, Zhao K, Chi Y, Liu B, Min X, et al. Detection of influenza viruses by coupling multiplex reverse-transcription loop-mediated isothermal amplification with cascade invasive reaction using nanoparticles as a sensor. Int J Nanomedicine 2017;12:2645-56.  Back to cited text no. 44
    
45.
Yaren O, Alto BW, Gangodkar PV, Ranade SR, Patil KN, Bradley KM, et al. Point of sampling detection of zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BMC Infect Dis 2017;17:293.  Back to cited text no. 45
    
46.
Oloniniyi OK, Kurosaki Y, Miyamoto H, Takada A, Yasuda J. Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP). J Virol Methods 2017;246:8-14.  Back to cited text no. 46
    
47.
Teoh BT, Sam SS, Tan KK, Johari J, Danlami MB, Hooi PS, et al. Detection of dengue viruses using reverse transcription-loop-mediated isothermal amplification. BMC Infect Dis 2013;13:387.  Back to cited text no. 47
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04