Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1407 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (519 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~ Case Report
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed646    
    Printed16    
    Emailed0    
    PDF Downloaded42    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
CASE REPORT
Year : 2019  |  Volume : 37  |  Issue : 1  |  Page : 127-131
 

Pulmonary Mycobacterium kyorinense disease: A case report and review of literature


1 Department of HIV, ICMR-National Institute for Research in Tuberculosis, Chennai, Tamil Nadu, India
2 Department of Clinical Research, ICMR-National Institute for Research in Tuberculosis, Chennai, Tamil Nadu, India
3 Department of Bacteriology, ICMR-National Institute for Research in Tuberculosis, Chennai, Tamil Nadu, India

Date of Web Publication16-Aug-2019

Correspondence Address:
Dr. Chandrasekaran Padmapriyadarsini
Department of Clinic Research, ICMR-National Institute for Research in Tuberculosis, 1, Mayor Sathyamoorthy Road, Chetpet, Chennai - 600 031, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_19_94

Rights and Permissions

 ~ Abstract 


We report here the first case of pulmonary infection due to Mycobacterium kyorinense in a 55-year-old hypertensive woman treated for pulmonary tuberculosis earlier on two occasions. She presented with productive cough, intermittent episode of left-sided chest pain, loss of appetite, low-grade fever, and breathlessness. Sputum cultures revealed non-tuberculous mycobacteria (NTM). She remained persistently symptomatic with sputum cultures positive for acid-fast bacilli even after 6 months of treatment. Hence, a 16SrRNA gene amplification and sequencing were done that revealed M. kyorinense. Based on the guidelines of the American Thoracic Society, she was started on weight-based dosing of clarithromycin, levofloxacin, ethambutol, isoniazid and injection amikacin daily. The patient improved symptomatically and became culture-negative after 3 months of therapy with the above regimen and continued to be culture negative for 12 months of treatment. She continues to remain symptom-free without evidence of any clinical or bacteriological relapse.


Keywords: 16SrRNA, non-tuberculous mycobacteria, rifampicin resistance


How to cite this article:
Saranathan R, Padmapriyadarsini C, Sivaramakrishnan GN, Perumal BK, Kannayan S, Joseph B, Gopalan N, Hanna LE. Pulmonary Mycobacterium kyorinense disease: A case report and review of literature. Indian J Med Microbiol 2019;37:127-31

How to cite this URL:
Saranathan R, Padmapriyadarsini C, Sivaramakrishnan GN, Perumal BK, Kannayan S, Joseph B, Gopalan N, Hanna LE. Pulmonary Mycobacterium kyorinense disease: A case report and review of literature. Indian J Med Microbiol [serial online] 2019 [cited 2019 Oct 21];37:127-31. Available from: http://www.ijmm.org/text.asp?2019/37/1/127/264497





 ~ Introduction Top


Mycobacterium kyorinense, a rare pathogenic Mycobacterium, was first isolated from a Japanese patient suffering from pneumonia in 2007.[1] Till date, 16 cases of M. kyorinense infection have been reported from regions including Japan, Brazil, Australia and Saudi Arabia. Majority of them were pulmonary infections while three were extra-pulmonary infections, such as lymphadenitis and arthritis.[2],[3],[4],[5],[6],[7] Laboratory identification of this bacterial species seems to be critical for the successful management of this disease as it does not respond to the conventional non-tuberculous mycobacteria (NTM)/anti-tuberculosis (TB) regimen.[3]M. kyorinense infection has never been reported from India.[3],[4],[5],[6],[7] This article reports the first case of M. kyorinense pulmonary infection in an immunocompetent woman from India and its successful treatment with clarithromycin and levofloxacin.


 ~ Case Report Top


A 55-year-old female was referred to the National Institute for Research in Tuberculosis (NIRT), Chennai, India, for recurrent episodes of productive cough of 2 months duration, loss of appetite for a month and low-grade fever with breathlessness for 10 days. She also experienced intermittent episodes of left-sided chest pain for 4 years. She had been treated for pulmonary TB twice before – once before 10 years and again before 1 year. During both episodes of treatment, she had been regular with her anti-TB treatment and was declared cured of the disease at the end of treatment. She was on medications for systemic hypertension and ischemic heart disease with dilated cardiomyopathy for the past 3 years. She worked as a housemaid and had the habit of using nasal snuff.

Physical examination revealed a tall, pale, and thin built female with a height of 156 cm and weight of 40.9 kg. On chest auscultation, coarse crackles were heard in both lung fields. There were no abnormal laboratory findings except for low hemoglobin (11.5 g/dL). Her chest radiograph showed infiltration in both lungs, involving five zones of the lung [Figure 1]a. Computed tomography imaging showed patchy areas of consolidation with calcification in both lungs [Figure 1]b and a cavity in the left upper lobe. Sputum smear and culture for acid-fast bacilli (AFB) were positive in three consecutive expectorated sputum samples. Following growth of Mycobacterium after 6 weeks in solid culture, it was sent for species identification by the line probe assay (LPA). LPA was negative for Mycobacterium tuberculosis complex and LPA for NTM did not match with any pattern from both GenoType Mycobacterium CM and GenoType Mycobacterium AS (Hain life sciences, Nehren, Germany). Instead, varying bands in the region for M. kansasii were seen raising the doubt of a variant of M. kansasii or mixed infection or a rare mycobacterial infection.
Figure 1: (a) Chest x-ray showing calcification in both lung fields, cavity in left upper lobe with dilated vessels and cardiac enlargement. (b) Computed tomography scan showing plethora of mosaic pattern in both the lungs with medium thick wall and calcification in left upper lobe. (c) Phylogenetic tree constructed using MEGA V 5.05 by neighbourhood joining method with the 16SrRNA gene sequences of representative mycobacterium species closely related to Mycobacterium kyorinense and NTM_1 strain obtained in this study

Click here to view


As the patient's respiratory symptoms were worsening, it was decided to give her the benefit of doubt and as M. kansasii is the most common pulmonary NTM in this part of the country; she was initiated on treatment for M. kansasii with a daily regimen of isoniazid (300 mg), rifampicin (450 mg) and ethambutol (800 mg). However, as even after 6 months of treatment, there was no clinical improvement and she remained symptomatic with sputum smears and cultures positive for AFB, two cultures were sent for 16SrRNA gene amplification and sequencing. The genomic DNA extracted from the cultures was used as a template for 16SrRNA gene amplification with 16S forward (5' GAGAGTTTGATCCTGGCTCAG 3') and 16S reverse (5' ACGGCTACCTTGTTACGACTT 3') primers. The amplicons were purified, sequenced in AB 3100 capillary sequencer (Applied Biosystems, USA) and aligned by NCBI-Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). We obtained nearly full-length sequence (1433 bp) which showed 99% identity with M. kyorinense. The sequence was submitted to Genbank (Accession number: MH005065.1). Phylogenetic analysis with the closely related Mycobacterium sp. 16SrRNA gene sequences was performed using MEGA v 5.05 tool. M. kyorinense strain NTM_1 showed proximity towards M. kyorinense reference strain (Accession n. JQ717033) [Figure 1]c. Drug susceptibility test by MGIT960 using single concentrations of drugs showed susceptibility to levofloxacin (1.0 μg/ml), moxifloxacin (2.0 μg/ml), ethambutol (5.0 μg/ml) and resistant to isoniazid (0.1 μg/ml), rifampicin (1.0 μg/ml), amikacin (1.0 μg/ml) and para-aminosalicylic acid (2.4 μg/ml). Based on the recommended regimen in literature and the drug susceptibility profile, she was started on clarithromycin (500 mg twice daily), levofloxacin (500 mg once daily), ethambutol (800 mg once daily) and amikacin (500 mg once daily).[3],[4],[5],[6],[7]

Following the initiation of combination therapy with clarithromycin and levofloxacin along with other drugs, the patient showed good clinical response with subsidence of clinical symptoms. There was an improvement in radiological findings and conversion of sputum smear and cultures, 3 months after treatment initiation. Injection amikacin was stopped after 9 months of treatment, and oral medicines alone were continued for 12 months post-sputum culture negativity; pulmonary M. kyorinense disease has not relapsed.


 ~ Discussion Top


Till date, only 16 cases had fulfilled the criteria for a clinically significant infection with M. kyorinense.[8] The reported 16 cases were from Japan, Brazil, Australia and Saudi Arabia and were isolated from immunocompetent patients with extensive clinical disease.[3],[4],[5],[6],[7] Among the 16 cases, 13 presented with respiratory failure/infection and two had lymphadenitis, while the other had arthritis. Five of the patients with respiratory infection died due to the infection and 9 improved in due course of treatment and recovered subsequently [Table 1]. The outcome of one patient from Australia and another patient from Japan is unknown.[1],[4] However, the Australian patient remained culture positive even after 6 months of therapy with appropriate antibiotics which may be attributed to the uncertainties on adherence to the medication and her continued smoking during medication.[4]
Table 1: Case details, antibiogram, treatment and outcome of Mycobacterium kyorinense infections reported till date

Click here to view


Identification/diagnosis

The symptoms and clinical features of M. kyorinense infection are very similar to other NTM infections and therefore, most clinicians usually start the patients on NTM regimen with clarithromycin tablets. Uncertainties in species identification of M. kyorinense prevail in most clinical set up as it is not included in the GenoType Mycobacterium CM. In most of the cases, it has been presumed to be either Mycobacterium celatum or Mycobacterium branderi due to the presence of some of the bands, but not all, in the LPA panel.[4] However, polymerase chain reaction (PCR) followed by direct sequencing of 16S rRNA gene and/or rpoB or hsp65 has been described to be the gold standard method for the identification of M. kyorinense and other Mycobacterium species.[9],[10] All the reported cases of M. kyorinense have sequenced either 16SrRNA gene and/or rpoB or hsp65 gene for precise identification at the species level.[3],[4],[5],[6],[7] Campos et al. have attempted to speciate M. kyorinense through PCR restriction enzyme pattern analysis (PRA), which can be implemented in the laboratories for the identification of this rare pathogen. Amplification and restriction digestion of hsp65 by BstEII and HaeII resulted in restriction pattern which showed the closest match towards M. celatum type 2 in PRA site database (http://app.chuv.ch/prasite/index.html). As the restriction pattern was novel, it was deposited in the database as M. kyorinense based on maximal similarity in the 16SrRNA gene sequence analysis.[9] PRA can also, therefore, be implemented in diagnostic laboratories as an alternate option for sequencing to identify this bacterium. In addition to the molecular identification methods, biochemical tests such as arylsulphatase activity, tellurite reduction and heat-stable catalase production can also distinguish M. kyorinense from M. celatum and M. branderi.[3]

Epidemiology

M. kyorinense is a rarely reported pathogen with a handful of reports and a very few incidences globally.[3],[4],[5],[6],[7] Nevertheless, we can also speculate that the incidence rates may be underestimated due to difficulties in diagnosis with the available resources. M. kyorinense was earlier suspected to be region-specific as there was a cluster of infections with 13 cases reported only from Japan.[3] However, subsequently, there were cases reported from Brazil, Australia and Saudi Arabia, now the present case from India confirming that this bacterium is not region-specific but spread across the continents.[4],[9] Molecular epidemiological facts about these strains are unknown due to the lack of typing/analysis investigations to delineate their proximity. However, the remarkable fact about the characterised strains is that the 16S rRNA gene sequences from different geographic regions differed slightly (99% similarity).

Microbiological characteristics

M. kyorinense is a non-pigmented, slow-growing organism that generally takes around 6 weeks to grow in the Löwenstein–Jenson medium and 18–20 days in Middlebrook 7H9 broth. The optimal temperature for growth ranges from 28°C to 42°C and DNA-DNA microplate hybridization analysis revealed <50% reassociation with closely related species such as M. celatum and M. branderi.[1] In the biochemical analysis, M. kyorinense isolates were negative for tween hydrolysis, urease activity, 3-day arylsulphatase activity, nitrate reductase, semiquantitative catalase, pyrazinamidase, tellurite reduction and niacin accumulation tests but positive for 14 days arylsulphatase activity and heat-stable catalase tests.[1],[3] Mycolic acid analysis using thin-layer chromatography (TLC) and matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry revealed the cell wall of M. kyorinense to possess alpha, keto and dicarboxymycolates.[1]

Treatment options

Although appropriate clinical guidelines for treating M. kyorinense are not available, existing case reports have shown significant success rates when fluoroquinolones and macrolides and/or aminoglycosides were used for treatment.[3],[4],[5],[6],[7] Early identification of this pathogen is also imperative for choosing the appropriate regimen for the treatment and better treatment response. From the available preceding case reports, we found that 10 patients, including ours, were treated initially with first-line anti-TB regimen containing rifampicin, isoniazid and ethambutol which turned out to be unsuccessful in all instances.[3],[4],[5],[6],[7] Ten patients who were administered macrolides and fluoroquinolones as the first-/second-line chemotherapy showed improvement and the infection subsided in nine patients. On the other hand, the five patients who did not receive appropriate therapy died eventually either due to the infection or associated comorbid conditions.[3],[4],[5],[6],[7] Minimal inhibitory concentration (MIC) assays for the M. kyorinense isolates in each case gave varied values. In general, almost all isolates had higher MICs for the first-line anti-TB drugs such as rifampicin, ethambutol, isoniazid and lower values for macrolides, aminoglycosides, and quinolones which constitute the treatment of choice for this pathogen. A higher level of rifampicin resistance in M. kyorinense is noteworthy as it is the pivotal drug for the management of M. tuberculosis. There is a possibility that these infections can be misdiagnosed with multi-drug resistant TB and treatment initiated for the same, delaying correct identification of M. kyorinense.

Genetic features

Ohtsuka et al. performed whole-genome sequencing of M. kyorinense (strain KUM060204) for the first-time using Ion PGM system (Life Technologies, USA).[11] The genome size was found to be 5.3 MB and comprised 5405 open reading frames with a G + C content of 66.9%.[11] Sequence analysis predicted Ser531Asp amino acid substitution in the rpoB to be responsible for rifampicin resistance. However, no substitutions could be identified in katG, inhA and aphC that could contribute to isoniazid resistance.[11] Overall, the sequencing results seem to suggest that the drug resistance mechanisms in M. kyorinense is different and not the same as that of M.tb.[11],[12]


 ~ Conclusion Top


M. kyorinense is emerging as a clinically significant pathogen that can manifest as a varied spectrum of disease in immunocompetent individuals. Isolation and identification of this pathogen seem to be difficult with standard mycobacterial laboratory techniques, and hence, it is important to perform repeated tests and molecular analysis to identify the AFB precisely for better treatment response. In TB-endemic countries, symptoms and clinical conditions of M. kyorinense infection mimic that of drug-resistant TB, especially when it involves the respiratory system. Hence, clinicians must be aware of this pathogen and have a high index of suspicion while treating intractable respiratory infection or pulmonary TB. Therapeutic options are not well defined but should include several months of treatment with a combination regimen. Of note is the fact that M. kyorinense is consistently resistant to the first-line anti-TB drugs, especially rifampin. Immune response of the individual should be boosted with simple host-directed therapy like good nutrition. As clinicians and microbiologists gain experience with M. kyorinense, further information can be obtained about the best diagnostic modality and treatment options.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Genbank accession number

The accession number for the nearly full-length 16SrRNA gene sequence of M. kyorinense NTM_1 strain is MH005065.1.

Acknowledgement

We would like to thank the Doctors, nurses and staff of the Department of Clinical Research, Department of Bacteriology and HIV-laboratory for their tireless contribution to the management of this patient. We extend our acknowledgments to Dr. Lavanya, District TB Officer, Chennai, Medical officers of the Revised National TB Control Programme and Dr. Srikanth Tripathy, Director, NIRT, for extending their support towards the management of NTM patients. This work is supported by an extramural grant from the Indian Council of Medical Research, Government of India.

Financial support and sponsorship

ICMR-Extramural.

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Okazaki M, Ohkusu K, Hata H, Ohnishi H, Sugahara K, Kawamura C, et al. Mycobacterium kyorinense sp. Nov. a novel, slow-growing species, related to Mycobacterium celatum, isolated from human clinical specimens. Int J Syst Evol Microbiol 2009;59:1336-41.  Back to cited text no. 1
    
2.
Wada H, Yamamoto M, Okazaki M, Watanabe T, Goto H. Isolation of Mycobacterium kyorinense in a patient with respiratory failure. Ann Intern Med 2009;150:568-70.  Back to cited text no. 2
    
3.
Ohnishi H, Yonetani S, Matsushima S, Wada H, Takeshita K, Kuramochi D, et al. Mycobacterium kyorinense infection. Emerg Infect Dis 2013;19:508-10.  Back to cited text no. 3
    
4.
Muruganandan S, Jayaram L, Wong JS, Guy S. Pulmonary cavitary Mycobacterium kyorinense (M. kyorinense) infection in an Australian woman. IDCases 2015;2:37-9.  Back to cited text no. 4
    
5.
Kobashi Y, Mouri K, Obase Y, Kato S, Oka M. Pulmonary Mycobacterium kyorinense disease showed clinical improvement following combined therapy with clarithromycin and levofloxacin. Intern Med 2012;51:1923-6.  Back to cited text no. 5
    
6.
Ikeue T, Yoshida H, Tanaka E, Ohi I, Noguchi S, Fukao A, et al. Pleuritis caused by Mycobacterium kyorinense without pulmonary involvement. Intern Med 2017;56:2785-90.  Back to cited text no. 6
    
7.
Varghese B, Enani M, Shoukri M, AlThawadi S, AlJohani S, Al-Hajoj S. Emergence of rare species of nontuberculous mycobacteria as potential pathogens in Saudi Arabian clinical setting. PLoS Negl Trop Dis 2017;11:e0005288.  Back to cited text no. 7
    
8.
Griffith DE, Aksamit T, Brown-Elliott BA, Catanzaro A, Daley C, Gordin F, et al. An official ATS/IDSA statement: Diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med 2007;175:367-416.  Back to cited text no. 8
    
9.
Campos CE, Caldas PC, Ohnishi H, Watanabe T, Ohtsuka K, Matsushima S, et al. First isolation of Mycobacterium kyorinense from clinical specimens in Brazil. J Clin Microbiol 2012;50:2477-8.  Back to cited text no. 9
    
10.
Kim BJ, Lee SH, Lyu MA, Kim SJ, Bai GH, Chae GT, et al. Identification of mycobacterial species by comparative sequence analysis of the RNA polymerase gene (rpoB). J Clin Microbiol 1999;37:1714-20.  Back to cited text no. 10
    
11.
Ohtsuka K, Ohnishi H, Nozaki E, Pais Ramos J, Tortoli E, Yonetani S, et al. Whole-genome sequence of Mycobacterium kyorinense. Genome Announc 2014;2. pii: e01062-14.  Back to cited text no. 11
    
12.
Telenti A, Imboden P, Marchesi F, Lowrie D, Cole S, Colston MJ, et al. Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. Lancet 1993;341:647-50.  Back to cited text no. 12
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04