Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 164 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (977 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusions
 ~  References
 ~  Article Figures

 Article Access Statistics
    Viewed971    
    Printed29    
    Emailed0    
    PDF Downloaded57    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 36  |  Issue : 4  |  Page : 494-503
 

Characterization of In vitro inhibitory effects of consensus short interference RNAs against non-structural 5B gene of hepatitis C virus 1a genotype


1 Department of Pharmacology and Toxicology, College of Pharmacy, Umm Al Qura University, Makkah, Saudi Arabia
2 Department of Pharmaceutical Chemistry, College of Pharmacy, Umm Al Qura University, Makkah, Saudi Arabia
3 Infection Control Department, King Fahd Hospital, Ministry of Health, Jeddah, Saudi Arabia
4 Department of Biochemistry, College of Medicine, Umm Al-Qura Univeristy, Makkah, Saudi Arabia
5 Department of Laboratory Medicine, Faculty of Applied Medical Sciences, Al Baha University, Al Baha, Saudi Arabia
6 Department of Clinical Pharmacy, College of Pharmacy, Najran University, Najran, Saudi Arabia
7 Pharmaceutical Care Department, King Fahad Hospital, Ministry of Health, Madinah, Saudi Arabia

Date of Web Publication18-Mar-2019

Correspondence Address:
Prof. Imran Shahid
Department of Pharmacology and Toxicology, College of Pharmacy, Umm Al Qura University, Al-Abidiyah, P O Box. 13578, Makkah 21955
Saudi Arabia
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_17_146

Rights and Permissions

 ~ Abstract 

Purpose: Chronic hepatitis C has infected approximately 170 million people worldwide. The novel direct-acting antivirals have proven their clinical efficacy to treat hepatitis C infection but still very expensive and beyond the financial range of most infected patients in low income and even resource replete nations. This study was conducted to establish an in vitro stable human hepatoma 7 (Huh-7) cell culture system with consistent expression of the non-structural 5B (NS5B) protein of hepatitis C virus (HCV) 1a genotype and to explore inhibitory effects of sequence-specific short interference RNA (siRNA) targeting NS5B in stable cell clones, and against viral replication in serum-inoculated Huh-7 cells. Materials and Methods: In vitro stable Huh-7 cells with persistent expression of NS5B protein was produced under gentamycin (G418) selection. siRNAs inhibitory effects were determined by analysing NS5B expression at mRNA and protein level through reverse transcription-polymerase chain reaction (PCR), quantitative real-time PCR, and Western blot, respectively. Statistical significance of data (NS5B gene suppression) was performed using SPSS software (version 16.0, SPSS Inc.). Results: siRNAs directed against NS5B gene significantly decreased NS5B expression at mRNA and protein levels in stable Huh-7 cells, and a vivid decrease in viral replication was also exhibited in serum-infected Huh-7 cells. Conclusions: Stable Huh-7 cells persistently expressing NS5B protein should be helpful for molecular pathogenesis of HCV infection and development of anti-HCV drug screening assays. The siRNA was effective against NS5B and could be considered as an adjuvant therapy along with other promising anti-HCV regimens.


Keywords: Hepatitis C virus, non-structural 5B protein, real-time polymerase chain reaction, RNA interference, stable human hepatoma-7 cells


How to cite this article:
Shahid I, Almalki WH, Ibrahim MM, Alghamdi SA, Mukhtar MH, Almalki SS, Alkahtani SA, Alhaidari MS. Characterization of In vitro inhibitory effects of consensus short interference RNAs against non-structural 5B gene of hepatitis C virus 1a genotype. Indian J Med Microbiol 2018;36:494-503

How to cite this URL:
Shahid I, Almalki WH, Ibrahim MM, Alghamdi SA, Mukhtar MH, Almalki SS, Alkahtani SA, Alhaidari MS. Characterization of In vitro inhibitory effects of consensus short interference RNAs against non-structural 5B gene of hepatitis C virus 1a genotype. Indian J Med Microbiol [serial online] 2018 [cited 2019 Dec 6];36:494-503. Available from: http://www.ijmm.org/text.asp?2018/36/4/494/254384



 ~ Introduction Top


Hepatitis C virus (HCV) infection is a severe human liver health problem which has affected around 170 million people worldwide.[1] HCV initiates replication in the cytoplasm of host cells after the formation of a replication complex.[2] A key enzyme of this membrane-associated replication complex is a non-structural 5B protein (NS5B; RNA-dependant RNA polymerase), which is responsible for HCV replication.[2] It catalyses the formation of a complementary negative (−ve) strand RNA by using the positive (+ve) strand viral RNA as a template.[3] NS5B polymerase activity produces multiple single-stranded RNAs of +ve polarity from complementary (−ve) strand RNA that serves as a template for further replication and translation.[3] NS5B consensus sequence motifs (D220, D225, G317, D318, D319) are highly conserved across all HCV genotypes and all the known RNA-dependant RNA polymerases.[3],[4] However, the poor fidelity and error-prone nature of polymerase enzyme lead to high mutation rate in the growing mRNA chain, which generates many different isolates of HCV in an infected individual (known as HCV quasispecies).[3],[4] Therapeutic options are improving with time in the form of novel direct-acting antivirals (DAAs) with minimum side effects, short duration of therapy and significantly higher sustained virologic response rates (SVR; HCV RNA undetectable after 6-month treatment completion).[1] However, the therapy cost and treatment access are still out of reach in developing and low-economic countries and even in resource-rich nations.[1] The emergence of resistance-associated substitutions is also a potential pitfall of DAAs in treated patients which sometimes lead to treatment discontinuation.[1] Therefore, an improvement of existing therapies and searching of new ones is eagerly awaited to cure the infection in the near future.

RNA interference (RNAi) has been demonstrated as an ancient gene silencing mechanism in eukaryotes, fungi, plants, invertebrates and vertebrates.[4],[5] RNAi has emerged to develop different anti-mRNA based therapeutics as an alternative treatment strategy to treat viral infections in humans against tumours, in allergic reactions, in immunology and certain metabolic disorders.[6],[7] Several studies have described that short interference RNAs (siRNAs) can significantly inhibit virus replication by targeting HCV structural and non-structural proteins.[8],[9],[10],[11] RNAi working is technically better due to HCV replication in the cytoplasm of host cells (siRNA-degrading complex which acts only in cytoplasm), whereas other anti-mRNA based therapeutics tend to silence genes at the nuclear level.[7],[12] Furthermore, during cell cytoplasm division, siRNA becomes 'diluted' to nullify their toxic effects on cell contents.[7] Similarly, the RNAi anti-viral potential is transient and remains effective approximately 3–7 days after that siRNA naturally degrades and disappears.[7] Hence, the drug toxicities and adverse drug effects could be less as compared to interferon (IFN) alpha and RBV-based therapeutic regimens.[7]

The current study was undertaken to explore the antiviral potential of genome-specific, chemically synthesised siRNAs directed against NS5B gene of HCV 1a genotype in stable human hepatoma 7 (Huh-7) cell clones. The therapeutic potential of siRNAs to inhibit viral replication was also demonstrated by silencing NS5B gene in serum-inoculated Huh-7 cells. The synergistic potential of siRNAs to inhibit viral replication was also evaluated by using a combination of siRNAs targeting different regions of the viral genome. The findings of this study reveal that the establishment of stable Huh-7 cells persistently expressing NS5B protein up to 30 days' post-transfection could be helpful in the development of anti-HCV drug screening assays as the protein itself is the most promising drug active site for the design of novel anti-HCV compounds. Furthermore, the inhibition of NS5B protein in stable Huh-7 cells, as well as decrease in virus replication in serum-infected Huh-7 cells, could be considered as an adjuvant therapeutic approach in future, if the safety and drug delivery issues related to siRNA can be resolved.


 ~ Materials and Methods Top


Construction of mammalian expression vector expressing non-structural 5B gene

The HCV NS5B gene encoding a non-structural protein was amplified by using 200 ng H/fl plasmid (expressing the whole genome of HCV 1a genotype and generously gifted by Dr. Hassan Hafeez, department of gastroenterology and hepatology, Fatima Memorial College of Medicine and Dentistry, Lahore, Pakistan) in a polymerase chain reaction (PCR) reaction. The PCR amplification was performed by using forward primer (5'-GCGATATCTCAATGTCTTATTCCTGG-3's with EcoRV restriction enzyme sites (5'-GCGATATC-3') and reverse primer (5'-AATCTAGATTACATCGGTTGGGGAGGAGG-3') with Xba 1 restriction sites (5'-AATCTAGATTA-3') with 2X PCR master mix (Fermentas, Maryland USA) by following the kit protocol. The PCR conditions were 95°C for 2 min (initial denaturation), 35 cycles of 95°C for 45 s (denaturation), 58°C for 30 s (annealing), 72°C for 40 s (extension) and 72°C for 10 min as final extension. The PCR product was gel electrophoresed to confirm the desired amplified NS5B product. For in vitro expression of NS5B gene in Huh-7 cells, pCR3.1/Flag-TAG mammalian expression vector expressing NS5B gene was constructed by following the standard cloning procedures. First, the 2X double strand Flag-TAG (Flag-TAG sense; BamHI-5'-GATCCATGGACTACAAGGACGACGAT GACAAGGACTACAAGGACGATGACAAGGT-3'-EcoRV) and Flag-TAG antisense; EcoRV-5'-ATCCTTGT CATCGTCGTCCTTGTAGTCGTTGTCATCGTCGT CCTGGTAGTCCATG-3'-BamHI)) was tagged to the C-terminus of the promoter. The Flag-TAG cloning into pCR3.1 vector was confirmed by 1.0% TAE (Tris base acetic acid EDTA) agarose gel electrophoresis, restriction digestion reaction and subsequent DNA sequencing of Flag-TAG. After that, the desired gene (NS5B) was cloned into a pCR3.1/Flag-TAG vector and confirmed by the same methods as those for Flag-TAG and sequencing DNA. The mammalian expression vector (pCR3.1/Flag-TAG/NS5B) was purified by performing maxi preparation with Qiagen plasmid purification kit (Qiagen, USA) by following the kit protocol. The purified isolated vector DNA was transfected into Huh-7 cells for further experiments.

Human hepatoma-7 cell cultivation and transfection of polymerase chain reaction 3.1/Flag-TAG/non-structural 5B vector

The Huh-7 cell line (ATCC, USA) was cultured in Dulbecco's modified eagle growth medium with the addition of cell culture tested 10% foetal bovine serum as a supplement (Sigma-Aldrich, USA), 100 IU/mL penicillin and 100 μg/mL streptomycin, and incubated at 37°C in an atmosphere of 5% CO2. Huh-7 cells were grown to 80% cell confluence before being split. Approximately 2 × 103 and 3 × 105 cells/well were seeded into 96 and 6-well cell culture plates and placed at 37C° with 5% CO2 for 24 h prior to use for 3-4,5-dimethylthiazolyl-2,5-diphenyltetrazolium bromide (MTT) cell proliferation assay and vector transfection, respectively.

After 24 h, cells grown to 80% confluence as observed under the compound microscope were transfected with constructed mammalian expression vector using lipofectamine 2000 (Invitrogen life technologies, CA) as a transfection reagent by following kit's protocol. Before transfection, the cells were washed with 5 ml of 1X PBS (phosphate buffer saline) and 800 μl of fresh cell culture media added to each well. The transfected cells were incubated at 37°C with 5% CO2 for 24 h after vector transfection. Cells transfected with pCR3.1/Flag-TAG vector only without NS5B gene were considered as a negative control (i.e. Mock transfection).

Non-structural 5B gene expression in stable human hepatoma-7 clones by reverse transcription-polymerase chain reaction and Western blot

Stable Huh-7 cells with consistent expression of NS5B gene 30 days post-transfection were produced by following the same protocol as previously reported.[2] RT-PCR and Western blotting were used to confirm NS5B expression at mRNA and protein levels, respectively. For this purpose, total cellular mRNA was extracted by using TRIzol ® reagent (Invitrogen Life Sciences, CA) in accordance with the kit's procedure and stored at −80°C before use. RNA was quantified using spectrophotometer (Nanodrop ND-1000, Optiplex, USA) and the first-strand cDNA was synthesised by following the protocol of first strand H minus cDNA synthesis kit (Fermentas, Maryland, USA). Sequence-specific RT-PCR primers were designed to analyse cellular gene GAPDH (Glyceraldehyde phosphate dehydrogenase; used as an internal control) and HCV genotype 1a NS5B gene expression by semi-quantitative RT-PCR. Expression of the target gene was normalised to the internal control (housekeeping genes, e.g., GAPDH). Expression levels of the internal control gene remained constant in all experimental and control cells under consideration. PCR amplification was performed by using 1 μl cDNA with forward primer (5'-GTACGCCCAGCAGACGAG-3') and reverse primer (5'-CCTCGTGACCAGGTAAAGGT-3') for NS5B gene with optimised PCR conditions (95°C for 2 min (initial denaturation), 35 cycles of 95°C for 1 min (denaturation), 58°C for 45 s (annealing), 72°C for 1 min (extension) and 72°C for 10 min as final extension)) by using 2X PCR master mix by following the kit protocol. Similarly, the RT-PCR was set using 1 μl cDNA of internal control cellular mRNA (i.e., GAPDH) with gene-specific forward primer (5'-ACCACAGTCCATGCCATCAC-3') and reverse primer (5'-TCCACCACCCTGTTGCTGTA-3') with optimised PCR conditions (95°C for 2 min (initial denaturation), 35 cycles of 95°C for 1 min (denaturation), 58°C for 50 s (annealing), 72°C for 1 min (extension) and 72°C for 10 min as final extension)) by using Taq DNA polymerase (Fermentas, Maryland, USA) by following the kit protocol. The PCR amplified product was electrophoresed on 1.8% TAE agarose gel to confirm GAPDH and NS5B gene in stable cell clones.

A standard Western blotting protocol was used for the protein expression of internal control and NS5B in the stable cell line. Briefly, total protein was extracted from stable cell line after day 30 post-transfection, and the protein concentration in each sample was measured using Pierce Coomassie (Bradford Assay ®) protein assay kit (Thermo Scientific, USA). Eighty to 100 μg of total protein was electrophoresed to 12% sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis) gel electrophoresis at 100 mV for 2 h in the separate cathode (100 mM Tris, 100 mM Tricine, 0.1% SDS, pH 8.3) and anode (0.2M Tris, pH 8.8) running buffers. The proteins were transferred onto nitrocellulose membranes by electroblotting in transfer buffer (35 mM glycine, 48 mM Tris, pH = 8.8 and 20% methanol) for 70 min at 16 mV. The membranes were blocked overnight in 5% skim milk at 4°C to prevent non-specific binding of antibodies. The primary antibody staining was done by using NS5B specific monoclonal antibody (Santa Cruz Biotechnology Inc., USA), and GAPDH (Santa Cruz Biotechnology Inc., USA) at 1:1000 dilution in TBS (Tris-buffered saline) solution (50 mM Tris, 150 mM NaCl, pH 7.6) containing 1% skim milk for 3–4 h at room temperature. Anti-goat anti-mouse horseradish peroxidase-conjugated antibody (Sigma-Aldrich, USA) were used as secondary antibody at 1:10000 dilution in TBS containing 1% skim milk. The proteins were detected by a chemiluminescence detection kit (Sigma-Aldrich, St. Louis, USA) in accordance with kit's procedure.

Short interference RNA designing, transfection to stable human hepatoma-7 cells and gene suppression analysis

The 'siRNA Target Finder' (Ambion, USA), a web-based tool (http://www.thermofisher.com/sa/en/home/references/ambion-tech-support/rnai-sirna/general-articles/-sirna-design-guidelines. html) was used to determine the highly conserved sequences of NS5B genome for siRNA designing. According to the programme, siRNAs starting with AA nucleotides at the 5'-end, followed by 19 nucleotides of the target gene (30%–50% GC enriched) were selected. A leader sequence 8 nucleotides in length (5'-CCTGTCTC-3') complementary to T7 RNA polymerase promoter was added at the 5'-end of selected siRNA sequence. The siRNAs named NS5B-is88 (NS5B-is88antisense 5'-AACCAGAATACGACTTGGAGCCCTGTCTC-3', NS5B-is88sense 5'-AAGCTCCAAGTCGTATTC TGGCCTGTCTC-3') and NS5B-is99 (NS5B-is99antisense 5'-AATCATTCAAAGACTCCATGGCCTGTCTC-3', NS5B-is99sense 5'-AACCATGGAGTCTT TGAATGACCTGTCTC-3') were designed in this manner. Similarly, NS3 gene targeted siRNAs NS3-is33 (NS3-is33antisense 5'-AATGTGGA CCAAGACCTTGTGCCTGTCTC-3', NS3-is33sense 5'-AACACAAGGTCTTGGTCCACACCTGTCTC-3') and NS3-is44 (NS3-is44antisense 5'-AATAATTTGT GACGAGTGCCACCTGTCTC-3', NS3-is44sense 5'-AATGGCACTCGTCACAAATTACCTGTCTC-3') were designed in the similar way. The later siRNAs were used to study combinatorial effects of siRNA mixture against viral replication in serum inoculated Huh-7 cells. The designed siRNA sequences were blasted on the NCBI (National Center for Biotechnology information) website (www.ncbi.nlm.nih.gov/BLAST) to ensure maximum sequence homology to HCV and non-homologous to the human genome. A negative control siRNA termed as scrambled siRNA (Sc siRNA) with sequences Sc-antisense 5'-AACCTGCATACGCGACTCGACCCTGTCTC-3' and Sc-sense 5'-AAGTCGAGTCGCGTATGCAG GCCTGTCTC-3' lacking significant sequence homology to human and HCV genome was also designed by the same programme. The designed siRNAs were chemically synthesised by using the Silencer siRNA construction kit (Ambion, USA) by following the kit protocol. The cellular toxicity of siRNAs in Huh-7 cells was determined by colorimetric MTT cell proliferation assay by following the same protocol as reported in 2015.[13]

To characterize siRNA inhibitory effects, siRNAs were transfected to stable Huh-7 cell clones against NS5B gene by using Lipofectamine™ 2000 as described for transfection of mammalian expression vector in Huh-7 cells. Total cellular mRNA and protein were extracted after 24 and 48 h to characterise differential expression of NS5B gene against sequence-specific siRNAs by RT-PCR and Western blotting.

The siRNA inhibitory effects against NS5B gene at the transcript level was determined by using NS5B specific RT-PCR primers, SYBR Green mix (Fermentas, Maryland, USA) following kit's protocol and quantitative real-time PCR (qPCR) (ABI 7500 Applied Biosystem, USA) at optimised qPCR conditions, i.e., 50°C for 10 min (initial hold), 95°C for 4 min (initial denaturation), 35 cycles of 94°C for 30 s (denaturation), 58°C for 30 s (annealing), 72°C for 40 s (extension) and 72°C for 7 min as final extension. qPCR for each trial was performed in triplicate, and for normalisation, the GAPDH gene expression was used as an internal control. Data acquisition was performed during the extension step. The quantitative siRNA inhibitory effect on NS5B gene was evaluated using the SDS3.1 software (Applied Biosystem, MA, USA).

Virus replication inhibition by non-structural 5B specific short interference RNAs in serum inoculated human hepatoma-7 cells

To explore NS5B sequence-specific siRNAs inhibitory effects on viral replication, we used HCV Real-TM Quant SC kit (Cepheid Sunnyvale, USA) and the SmartCycler ® (Cepheid Sunnyvale, USA). For in vitro viral replication in Huh-7 cells, the viral inoculation procedure published earlier was used.[8],[9],[10],[12] Informed consent was obtained from the patients whose sera were used for the in vitro replication assay, and ethical approval was obtained from the ethical review board of Umm Al-Qura University, Makkah, Saudi Arabia.

To characterise siRNA silencing impact on viral load, serum inoculated Huh-7 cells were seeded up to 60%–80% confluency in 24-well tissue culture plate and transfected with 50 nM siRNA/well as described earlier.[8],[9],[10],[12] Total cellular RNA was extracted from cells after 72 h incubation with siRNAs by using TRIzol ® reagent (Invitrogen Life Sciences, CA) in accordance with the kit's procedure. Quantitative detection of viral load in serum infected cells after siRNA treatment was performed by using Real-Time PCR (Smart Cycler ®, Cepheid Sunnyvale, USA). The viral load in each trial was calculated by using the following equation.

HCV IU/ml = (Cy3 STD/Res/FAM STD/Res) × Coefficient IC

Statistical analysis

Relative gene expression of NS5B as compared to an internal control (GAPDH) and siRNA gene suppression relative to control/scrambled RNA was analysed using SPSS software (version 16.0, SPSS Inc., IBM, NY, USA). For this purpose, the data were collected as a mean ± standard deviation and analysed for standard error and level of significance. A value of P < 0.05 was considered statistically significant where applicable.


 ~ Results Top


Non-structural 5B gene expression at mRNA and protein levels in stable human hepatoma-7 cell clones

The cloned NS5B gene was transfected into Huh-7 cells by using Lipofectamine, and stable cell clones were generated under the selection pressure of antibiotic gentamycin (G418). Total cellular RNA and protein were extracted from Huh-7 cells at day 10, 20 and 30 post-transfection to evaluate NS5B gene and protein expression. Viral RNA was transcribed to cDNA for the RT-PCR and protein was used for Western blot analysis [Figure 1]. GAPDH expression was used as an internal control and for data normalisation, both in vector transfected stable cell clones and non-transfected cell lines (i.e. negative control). The RT-PCR gel and Western blot showed that there was no difference in the expression of GAPDH in stable Huh-7 cells expressing NS5B gene as compared to non-transfected Huh-7 cells [Figure 1]a and [Figure 1]c. The RT-PCR product and Western blot showed a persistent and constitutive expression of NS5B gene and protein in stable cell clones at days 10, 20 and 30 post-transfection, respectively [Figure 1]b and [Figure 1]d.
Figure 1: Non-structural 5B expression in stable human hepatoma-7 cells. (a) GAPDH expression (used as an internal control) for the confirmation of cDNA and data normalisation. The gel electrophoresis showed that there was no difference in the expression of GAPDH in mock transfected (empty vector polymerase chain reaction 3.1/FlagTAG) human hepatoma-7 cells and polymerase chain reaction 3.1/FlagTAG/non-structural 5B-transfected stable cell clones. M: 100 bp DNA ladder, -ve (c) negative polymerase chain reaction control without human hepatoma-7 cells, human hepatoma-7: human hepatoma-7 cells with Mock transfection, D10-D30: stable cell clones transfected with polymerase chain reaction 3.1/FlagTAG/non-structural 5B vector. (b) Non-structural 5B mRNA expression in stable cell clones. M: 100 bp DNA ladder, -ve (c) Human hepatoma-7 cells with mock transfection, D10-D30: non-structural 5B gene expression at days 10, 20, and 30 respectively. (c and d): The GAPDH and non-structural 5B protein expression at days 10, 20, and 30 post-transfection confirmed by Western blotting with GAPDH and non-structural 5B specific antibodies

Click here to view


Non-structural 5B gene silencing in stable human hepatoma-7 cell clones by consensus short interference RNAs

The characterisation of gene silencing effects of selected conserved siRNAs directed against NS5B gene was performed in a dose-dependent manner. We used 10 nM to 50 nM doses of synthesised siRNAs to investigate their gene silencing specificity while evaluating NS5B inhibition in stable cell clones at 24 and 48 h at mRNA and protein levels by RT-PCR, qPCR, and Western blotting, respectively. This time-dependant siRNA inhibitory analysis was according to Khaliq et al., who demonstrated in vitro siRNA inhibitory effects against core (C) gene of HCV genotype 1a up to 3 days post-transfection.[8],[9] The preliminary NS5B RNA suppression analysis at different doses from 10nM to 50nM was performed by RT-PCR which revealed significant inhibition of NS5B mRNA after 48 h post-transfection with NS5B-is88 siRNA at 50 nM dose than 24 h as compared to control [Figure 2]a and [Figure 2]b. However, siRNA NS5B-is99 showed more effect after 24 h post-transfection at 50nM dose than 48 h as compared to control [Figure 2]a and [Figure 2]b. The findings of RT-PCR were further validated by qPCR by using NS5B gene-specific primers and GAPDH as an internal control [Figure 2]c. The relative percentage inhibition of NS5B RNA in siRNA co-transfected cells at 50 nM dose over control expression were calculated while normalising it with GAPDH in qPCR. NS5B mRNA decreased by 70% (*P < 0.020) in stable cells treated with siRNA NS5B-is88 and 74% (*P < 0.015) with NS5B-is99 after 24 h post-transfection [Figure 2]c, whereas NS5B mRNA was decreased by 72% (^P < 0.003) with NS5B-is88 and 71% (^P < 0.010) with NS5B-is99 siRNAs at 48 h post-transfection. No significant mRNA inhibition was reported in cells treated with scrambled siRNA [Figure 2]c. Thus, siRNA NS5B-is99 showed maximum inhibition of NS5B gene (70%–75%) in stable Huh-7 cell clones at 24 and 48 h post-transfection [Figure 2]c.
Figure 2: Gene silencing effects of short interference RNAs against non-structural 5B in stable human hepatoma-7 cell clones. The silencing effects of short interference RNA targeting non-structural 5B gene were analysed by RT-polymerase chain reaction, Western blotting, and real-time polymerase chain reaction. (a and b): mRNA expression of non-structural 5B gene after 24 and 48 h post-transfection with 50nM short interference RNAs compared to mock (polymerase chain reaction 3.1/FlagTAG), positive control (polymerase chain reaction 3.1/FlagTAG/non-structural 5B) and scrambled short interference RNA-treated cells expression. All experiments were performed in triplicate. mRNA expression of GAPDH was used as an internal control both in short interference RNA-treated and untreated cells. L: 100 bp DNA ladder, M: human hepatoma-7 cells with mock transfection, C: Positive control cells. (c) Quantitative real-time polymerase chain reaction showed a relative decrease in mRNA expression of non-structural 5B after 24 and 48 h post-transfection with short interference RNAs as compared to controlled expression (i.e., Mock transfection). Each sample was tested in triplicates. The error bars indicate mean (n = 3) ± standard deviation whereas P* and P^ designated significant differences between connected groups. (d): short interference RNA gene silencing effect at the protein level as determined by Western blotting. M: human hepatoma-7 cells with mock transfection, C: Positive control cells

Click here to view


The siRNA inhibitory effects were also confirmed at the protein level using NS5B-specific antibodies by Western blotting. Stable Huh-7 cells treated with siRNAs showed reduced NS5B protein expression at 24 and 48 h post-transfection as compared to control [Figure 2]d. The immunoblot results also showed relatively more reduced expression of viral NS5B protein with NS5B-is99 siRNA than NS5B-is88 at 24 h post-transfection. However, the relative NS5B protein inhibition was almost equal at 48 h post-transfection with both siRNAs [Figure 2]d.

To ensure that the results observed were not due to the toxicity of siRNAs to Huh-7 cells, cell viability and cytotoxic activity of all siRNAs to be tested was determined by MTT cell proliferation assay in a dose-dependent manner (starting from 10nM up to 50nM) before transfection into stable Huh-7 cell clones. The result of the MTT assay revealed that at the most concentrated dose tested (50 nM dose/well), siRNAs had no cytotoxic effects on Huh-7 cells and cell proliferation remains unaffected. Huh-7 cells transfected with scrambled siRNAs and without any treatment were used as a control. The percentage cell viability was in a range of 97%–99% as compared to control (mock transfection, i.e., pCR3.1/Flag-TAG) and scrambled siRNAs treated cells [Figure 3].
Figure 3: Cytotoxic analysis of short interference RNA by 3-4,5-dimethylthiazolyl-2,5-diphenyltetrazolium bromide cell proliferation assay. Each trial was performed in triplicate presenting data as mean (n = 3) ± standard deviation both for short interference RNA-treated and control cells

Click here to view


Inhibition of virus replication in serum inoculated human hepatoma-7 cells by short interference RNAs

The siRNAs specificity to silent NS5B gene expression in stable cell clones was further speculated to be active in serum-inoculated Huh-7 cells containing replication-competent HCV, as described in many studies.[8],[9],[10],[12] Thus, viral load was determined in siRNA-treated and serum-inoculated Huh-7 cells using sera from confirmed HCV-infected patients. A relative percentage decrease in viral load in siRNA-treated cells as compared to positive control was calculated by detecting 5'UTR (untranslated region; by using 5'UTR specific primers) of viral copy number through qPCR. The maximum decrease in viral load was noticed at day 3 postinfection where siRNA NS5B-is99 showed 71% (P < 0.05) viral RNA reduction as compared to NS5B-is88, which demonstrated a 68% (P < 0.05) decrease in viral copy number [Figure 4]a. These findings suggested that the inhibition of NS5B gene had a significant inhibitory impact on HCV replication in Huh-7 cells infected with patient isolates. Consequently, the use of siRNAs for the down-regulation of NS5B expression could be useful for the reduction of virus replication.
Figure 4: Short interference RNAs inhibitory effects against viral replication in serum-inoculated human hepatoma-7 cells. (a) Quantitative real-time polymerase chain reaction analysis of the viral load using 5' untranslated region-specific primers. (b and c) The inhibitory effects of short interference RNA mixtures on viral load containing different short interference RNAs targeting multiple regions of hepatitis C virus genome. Each experiment was performed in triplicate, and the data were collected as the mean of relative percentage decrease in viral load in short interference RNA-treated cells versus positive control (i.e., S 1a). The error bars indicate mean (n = 3) ± standard deviation with a value of P < 0.05 being statistically significant

Click here to view


Short interference RNA synergism against virus replication in serum inoculated human hepatoma-7 cells

Viral escape mutations often emerge when DAAs and anti-mRNA based therapies are administered against HCV both in vitro and in vivo.[7] Similarly, siRNA off-target effects may also decrease the inhibition of viral replication. Several studies suggest that siRNA-based off-target effects may nullify while using siRNAs in combination targeting multiple genome sites and selecting highly conserved targeted gene regions for siRNA designing.[7] Thus, the synergistic inhibitory potential of siRNAs, when used in combination against NS5B in serum inoculated Huh-7 cells was tested by qPCR. The results showed that siRNA mixture containing NS5B genome specific siRNAs (NS5B-is88+ NS5B-is99) decreased viral load by 82% (P < 0.05) as compared to individual inhibition (i.e., 68%–71% [P < 0.05] respectively) [Figure 4]a. We also determined the inhibitory effects of a synthetic siRNAs mixture targeting a different conserved region of the HCV genome [Figure 4]b and [Figure 4]c. The siRNAs directed against NS3 (A serine protease involved in downstream cleavage of hepatitis C polyprotein during HCV translation) and NS5B genes (i.e., NS3-is44+ NS5B-is99) decreased HCV viral titer by 84% (P < 0.05) as compared to siRNA inhibitory effects alone (i.e., 70% and 68% [P < 0.05], respectively) [Figure 4]c. Similarly, siRNA mixture containing NS3-is33 and NS5B-is88 siRNAs also showed a marked reduction of viral load up to 82% (P < 0.05) than siRNA inhibitory effects alone against viral replication (i.e. 64% and 71% [P < 0.05] respectively) [Figure 4]b. The findings indicate that the siRNAs used in combination by significantly decreasing viral load could be a good strategy to decrease virus replication and for the prevention of siRNA off-target effects.


 ~ Discussion Top


HCV is a severe human liver pathogen which causes chronic hepatitis C and associated hepatic diseases in infected individuals.[14] The global prevalence of the infection, therapy costs, and treatment associated adverse effects eagerly demand to improve the existing anti-HCV treatment strategies and find novel alternative therapeutic options to treat the infection.[1] Recent advances in molecular medicine and extraordinary efforts in drug discovery models have been shifted the treatment paradigms to develop novel methodologies to treat the infectious diseases.[1],[15] Nowadays, RNAi-based methodologies are the primary means of genome function studies, gene silencing, and development of gene-based therapies in cancer research, virology and certain metabolic disorders.[5],[6],[8],[9],[16] Many studies have also been reported that RNAi activity blocks the synthesis of viral replicon by targeting multiple genome sequences of the virus.[17],[18],[19],[20] Similarly, due to low cytotoxicity, and genome specificity, RNAi activity may offer a better therapeutic option against viral infections.[7]

In this study, we characterised the inhibitory effects of sequence-specific small interference RNAs directed against the NS5B protein in stable Huh-7 cell culture system as well as against virus replication in vitro serum inoculated Huh-7 cells. The specificity of siRNAs to degrade mRNA of the targeted gene was evaluated in stable cell clones in a dose-dependent manner. Huh-7 cells persistently supporting HCV replication are very useful for virus life cycle studies, in exploring the molecular pathogenesis of the disease and development of in vitro anti-HCV drug screening assays.[2],[21],[22],[23],[24] We reported here the establishment of stable Huh-7 cell lines persistently expressing NS5B protein after 30 days post-transfection. Reproducible expression of NS5B was apparent at mRNA and protein level at different time intervals (days 10, 20 and 30, respectively) after post-transfection as determined by RT-PCR and Western blotting [Figure 1]. The NS5B interaction with host cellular factors of Huh-7 cells could facilitate to understand virus replication and stable cell lines expressing NS5B protein would be useful for drug activity analysis of novel compounds being investigated as NS5B inhibitors for HCV treatment.[2],[25]

HCV life cycle is still not completely understood, but the improved understandings demonstrate that the virus replicates in the cytoplasm of host cells and key enzyme responsible for virus replication is an RNA-dependent RNA polymerase (i.e., RdRp; NS5B protein).[26],[27],[28] Consequently, the inhibition of NS5B protein blocks the viral replication that makes it an attractive and potential drug target site. The NS5B protein complex is highly conserved among all the known RdRps and contains discrete fingers, palm, and thumb subdomains.[2],[29] A unique feature of this polymerase is an encircled active site developed due to extensive interactions between the finger and thumb subdomains.[2],[29] Functional residues D220, D319, and D318, are actively involved in transferring nucleotide to an active catalytic subunit of the NS5B protein.[2],[29] We designed unique consensus siRNAs against these regions which have not been studied earlier in a stable Huh-7 cell line model. siRNA NS5B-is88 was designed from the target sequence of NS5B finger subdomain, whereas siRNA NS5B-is99 was chosen to the genome which encodes D220, D319, and D318 functional moieties. siRNAs with GC content of about 35%–50% and 21–25 nucleotide base pairs long were synthesised because siRNA <30 base pair long can be used only to induce RNAi activity into mammalian cells.[7],[11] As the nucleotide length exceeds to more than 30 base pairs, siRNAs may stimulate innate host immune responses resulting in an up-regulation of IFN stimulated nuclear factors which non-specifically degrade targeted mRNA as well as inhibit viral translation, and promotes cell death.[7],[11]

Lack of siRNA cell cytotoxicity was demonstrated by MTT cell proliferation assay in a dose-dependent manner [Figure 3]. The MTT cell proliferation assay was important to define an efficient and safe siRNA concentration (dose) which could be transfected to stable Huh-7 cells as well as to serum-inoculated cells to evaluate their gene silencing effects.

Several studies have been demonstrated that HCV replication and expression of structural and non-structural genes is potentially inhibited by RNAi in replicon cell lines.[30],[31],[32],[33],[34] In this study, our intention was to characterise the inhibitory effects of siRNAs on conserved regions of NS5B gene in stable cell culture system and further apply their gene silencing impact on viral load in serum inoculated cells. The results showed that siRNA inhibitory effects were much more significant as determined by RT-PCR and Western blotting [Figure 2]a, [Figure 2]b, [Figure 2]c. Relative quantification by qPCR further validated the specific inhibition of NS5B mRNA as compared to control expression. The most effective siRNA was NS5B-is99 (74% mRNA inhibition, *P < 0.015) designed from the genome region which constitutes functional residues of NS5B, indicating it as a potent site for siRNA gene silencing [Figure 2]d. mRNA inhibition was also significantly observed by siRNA NS5B-is88 (72%,^P < 0.003), which was directed against NS5B finger subdomain [Figure 2]d. These findings are in agreement with the previously reported studies which support potent RNAi activity against HCV in Huh-7 and derived cell lines.[8],[9],[31],[32],[33],[34]

We further elaborated the study to authenticate siRNAs inhibitory impact on viral replication in serum inoculated Huh-7 cells. Such in vitro cell culture models have been widely used to demonstrate productive viral infection as well as to evaluate the anti-HCV drug activity.[8],[9],[10],[12] HCV replication was demonstrated by detection of HCV 5' UTR by qPCR in Huh-7 cells from day 3 post-infection [Figure 4]. A significant decrease in HCV viral load was observed in the infected cells by the NS5B-directed siRNAs (68%–71%, P < 0.05) [Figure 4]a. The results were comparable with the findings of Jarczak et al., 2005 who described hairpin ribozymes and siRNA as effective inhibitors of HCV replication, while inhibiting 3'UTR and 5'UTR sequences, respectively.[32] The findings were also in agreement with Khaliq et al., 2010 and 2011 studies which demonstrated viral replication inhibition by using core (C) gene-specific synthetic and vector-based siRNAs against HCV genotype 3a full-length viral particles in Huh-7 cells.[8],[9] Our results were also in agreement with Zekri et al., 2009 who reported HCV genotype-4 replication inhibition in serum infected Huh-7 cells.[10]

siRNA off-target effects may decrease their specificity to inhibit viral replication when siRNA-based anti-mRNA therapies are administered to in vitro cell line models.[7] Furthermore, the emergence of viral escape mutants may develop resistance to anti-hepatitis C therapy.[1] A combination of several siRNAs targeting different regions of the HCV genome can be used to overcome such a caveat.[7],[35] In 2009, Shin et al. used constitutively expressed long duplex RNA, comprising multiplexed siRNAs against E2 and NS3 genes to prevent the probability of viral escape mutants.[30] By following the same strategy, we also evaluated the synergistic/additive inhibitory effects of siRNAs combination against viral load in serum-inoculated Huh-7 cells. The results showed that both siRNAs (NS5B-is88+ NS5B-is99) in conjunction decreased by 82% (P < 0.05) HCV viral load in serum-inoculated Huh-7 cells [Figure 4]a. Similarly, the combination of siRNAs directed against different genome sequences also revealed the additive inhibitory effects of siRNAs on HCV viral load in serum-treated cells [Figure 4]b and [Figure 4]c siRNAs combination NS3-is44+ NS5B-is99 showed 82% (P < 0.05) inhibition of viral load, while the maximum inhibitory effect of 84% (P < 0.05) was observed with the siRNAs combination NS3is33+ NS5B-is88 in serum-inoculated Huh-7 cells. Our results support the findings of Kim et al., 2006 and Liu et al., 2005 who reported a significant decrease in NS3 protein levels than Core (C) protein considering that more siRNA targeted sites are located on the upstream site of the viral genome.[20],[21] One possible hypothesis might be due to the possible interactions between different regions of the hepatitis C viral genome.[8],[9] The siRNAs combination experiments are somewhat interesting and would be more interesting to see in a confirmed HCV replication model in the future perspective of the studies. Our findings showed much more significant inhibition of viral replication than those reported by Khaliq et al., and Seo et al., who used siRNA and shRNAs to silence HCV genome in serum-inoculated Huh-7 cells.[8],[9],[19] However, the findings are contradictory to observations made by Randall et al., Wilson et al., Lisowski et al. and Kapadia et al., who demonstrated relatively low siRNA efficacy against viral replication.[18],[33],[34],[35] Interestingly, HCV expresses one single long mRNA as a whole genome, and one long polyprotein,[36] thus any siRNA that targets the HCV genome will stop the expression of HCV polyprotein, and thus all HCV proteins. In this point of view, the location to which the siRNA target is irrelevant, as long as it is a good 'siRNA.' In other words, we may say that “NS5B” specific siRNA will inhibit expression of NS3 (or any other HCV protein) as like it inhibits NS5B.[33],[35] Similarly, the target sequence specificity from the functional domains of the targeted gene to design and construct the most efficient siRNAs is of utmost importance.[7] About 14% of all amino acid residues in the HCV NS5B protein are highly variable and can lead to resistance to drugs targeting HCV NS5B protein.[37] In our study, the siRNA's targeted sequences were highly conserved only for HCV NS5B protein of genotype 1a as confirmed by sequence blast; however, found variable for other HCV genotypes and subtypes. In this scenario, if the consensus sequence of the siRNA target is variable across all other genotypes it might be a limitation of this study where siRNAs effectiveness against NS5B would be compromised/variable and viral escape mutants could emerge.

Other possibilities to reduce the chances of viral escape mutants are the choice of highly conserved sequences while synthesising siRNA or shRNA (short hairpin RNA).[7],[8],[9] Many studies describe genetic heterogeneity at the level of sequence conservations among different hepatitis C genotypes, for example, internal ribosome entry sites regions of 5' non-translated region (NTR) are extremely conserved whereas 3' NTR, and coding regions of NS3 and NS5B protein show relatively low degree of conservation.[38],[39]


 ~ Conclusions Top


Stable Huh-7 cells with persistent expression of HCV NS5B gene should be helpful to study an intricate interplay between cellular and viral factors during HCV replication and for the development of anti-HCV drug screening assays. siRNA inhibitory effects were effective against NS5B protein expression and virus replication demonstrating its therapeutic potential or as an adjuvant therapy along with other promising anti-HCV regimens as Pan et al. showed the additive inhibitory potential of siRNAs in combination with IFN.[40]

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

=

 
 ~ References Top

1.
Shahid I, AlMalki WH, Hafeez MH, Hassan S. Hepatitis C virus infection treatment: An era of game changer direct acting antivirals and novel treatment strategies. Crit Rev Microbiol 2016;42:535-47.  Back to cited text no. 1
    
2.
Moradpour D, Penin F, Rice CM. Replication of hepatitis C virus. Nat Rev Microbiol 2007;5:453-63.  Back to cited text no. 2
    
3.
Ranjith-Kumar CT, Cheng KC. Biochemical activities of the HCV NS5B RNA-dependent RNA polymerase. In: Tan SL, editor. Hepatitis C Viruses: Genomes and Molecular Biology. Norfolk (UK): Horizon Bioscience; 2006.  Back to cited text no. 3
    
4.
Poch O, Sauvaget I, Delarue M, Tordo N. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J 1989;8:3867-74.  Back to cited text no. 4
    
5.
Coburn GA, Cullen BR. Potent and specific inhibition of human immunodeficiency virus type 1 replication by RNA interference. J Virol 2002;76:9225-31.  Back to cited text no. 5
    
6.
Brummelkamp TR, Bernards R, Agami R. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell 2002;2:243-7.  Back to cited text no. 6
    
7.
Khaliq S, Khaliq SA, Zahur M, Ijaz B, Jahan S, Ansar M, et al. RNAi as a new therapeutic strategy against HCV. Biotechnol Adv 2010;28:27-34.  Back to cited text no. 7
    
8.
Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S, et al. Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes. Arch Virol 2011;156:433-42.  Back to cited text no. 8
    
9.
Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Pervaiz A, et al. Inhibition of core gene of HCV 3a genotype using synthetic and vector derived siRNAs. Virol J 2010;7:318.  Back to cited text no. 9
    
10.
Zekri AR, Bahnassy AA, El-Din HM, Salama HM. Consensus siRNA for inhibition of HCV genotype-4 replication. Virol J 2009;6:13.  Back to cited text no. 10
    
11.
Elbashir SM, Lendeckel W, Tuschl T. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 2001;15:188-200.  Back to cited text no. 11
    
12.
el-Awady MK, Tabll AA, el-Abd YS, Bahgat MM, Shoeb HA, Youssef SS, et al. HepG2 cells support viral replication and gene expression of hepatitis C virus genotype 4 in vitro. World J Gastroenterol 2006;12:4836-42.  Back to cited text no. 12
    
13.
Shahid I, Almalki WH, Almalki S, Al-Turkestany I, AlGhamdi H, AlMenshawi S. Inhibition of hepatitis C virus genotype 1a non-structural proteins by small interference RNA in human hepatoma cell lines. Pharmacol Pharm 2015;6:502-17.  Back to cited text no. 13
    
14.
Davis GL, Alter MJ, El-Serag H, Poynard T, Jennings LW. Aging of hepatitis C virus (HCV)-infected persons in the United States: A multiple cohort model of HCV prevalence and disease progression. Gastroenterology 2010;138:513-21, 521.e1-6.  Back to cited text no. 14
    
15.
Asad S, Ijaz B, Ahmad W, Kausar H, Sarwar MT, Gull S, et al. Development of persistent HCV genotype 3a infection cell culture model in huh-7 cell. Virol J 2012;9:11.  Back to cited text no. 15
    
16.
Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, et al. Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA. Virol J 2011;8:203.  Back to cited text no. 16
    
17.
Hannon GJ. RNA interference. Nature 2002;418:244-51.  Back to cited text no. 17
    
18.
Kapadia SB, Brideau-Andersen A, Chisari FV. Interference of hepatitis C virus RNA replication by short interfering RNAs. Proc Natl Acad Sci U S A 2003;100:2014-8.  Back to cited text no. 18
    
19.
Seo MY, Abrignani S, Houghton M, Han JH. Small interfering RNA-mediated inhibition of hepatitis C virus replication in the human hepatoma cell line huh-7. J Virol 2003;77:810-2.  Back to cited text no. 19
    
20.
Kim M, Shin D, Kim SI, Park M. Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model. Virus Res 2006;122:1-0.  Back to cited text no. 20
    
21.
Liu M, Ding H, Zhao P, Qin ZL, Gao J, Cao MM, et al. RNA interference effectively inhibits mRNA accumulation and protein expression of hepatitis C virus core and E2 genes in human cells. Biosci Biotechnol Biochem 2006;70:2049-55.  Back to cited text no. 21
    
22.
Butt S, Idrees M, Rehman IU, Ali L, Hussain A, Ali M, et al. Establishment of stable huh-7 cell lines expressing various hepatitis C virus genotype 3a protein: An in vitro testing system for novel anti-HCV drugs. Genet Vaccines Ther 2011;9:12.  Back to cited text no. 22
    
23.
Molina S, Castet V, Pichard-Garcia L, Wychowski C, Meurs E, Pascussi JM, et al. Serum-derived hepatitis C virus infection of primary human hepatocytes is tetraspanin CD81 dependent. J Virol 2008;82:569-74.  Back to cited text no. 23
    
24.
Buck M. Direct infection and replication of naturally occurring hepatitis C virus genotypes 1, 2, 3 and 4 in normal human hepatocyte cultures. PLoS One 2008;3:e2660.  Back to cited text no. 24
    
25.
Lázaro CA, Chang M, Tang W, Campbell J, Sullivan DG, Gretch DR, et al. Hepatitis C virus replication in transfected and serum-infected cultured human fetal hepatocytes. Am J Pathol 2007;170:478-89.  Back to cited text no. 25
    
26.
Ahmad W, Shabbiri K, Ijaz B, Asad S, Sarwar MT, Gull S, et al. Claudin-1 required for HCV virus entry has high potential for phosphorylation and O-glycosylation. Virol J 2011;8:229.  Back to cited text no. 26
    
27.
Ahmad W, Ijaz B, Javed FT, Jahan S, Shahid I, Khan FM, et al. HCV genotype distribution and possible transmission risks in lahore, pakistan. World J Gastroenterol 2010;16:4321-8.  Back to cited text no. 27
    
28.
Boonstra A, van der Laan LJ, Vanwolleghem T, Janssen HL. Experimental models for hepatitis C viral infection. Hepatology 2009;50:1646-55.  Back to cited text no. 28
    
29.
Biswal BK, Cherney MM, Wang M, Chan L, Yannopoulos CG, Bilimoria D, et al. Crystal structures of the RNA-dependent RNA polymerase genotype 2a of hepatitis C virus reveal two conformations and suggest mechanisms of inhibition by non-nucleoside inhibitors. J Biol Chem 2005;280:18202-10.  Back to cited text no. 29
    
30.
Shin D, Lee H, Kim SI, Yoon Y, Kim M. Optimization of linear double-stranded RNA for the production of multiple siRNAs targeting hepatitis C virus. RNA 2009;15:898-910.  Back to cited text no. 30
    
31.
McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA, et al. RNA interference in adult mice. Nature 2002;418:38-9.  Back to cited text no. 31
    
32.
Jarczak D, Korf M, Beger C, Manns MP, Krüger M. Hairpin ribozymes in combination with siRNAs against highly conserved hepatitis C virus sequence inhibit RNA replication and protein translation from hepatitis C virus subgenomic replicons. FEBS J 2005;272:5910-22.  Back to cited text no. 32
    
33.
Randall G, Grakoui A, Rice CM. Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs. Proc Natl Acad Sci U S A 2003;100:235-40.  Back to cited text no. 33
    
34.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, et al. RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc Natl Acad Sci U S A 2003;100:2783-8.  Back to cited text no. 34
    
35.
Lisowski L, Elazar M, Chu K, Glenn JS, Kay MA. The anti-genomic (negative) strand of hepatitis C virus is not targetable by shRNA. Nucleic Acids Res 2013;41:3688-98.  Back to cited text no. 35
    
36.
Sarwar MT, Kausar H, Ijaz B, Ahmad W, Ansar M, Sumrin A, et al. NS4A protein as a marker of HCV history suggests that different HCV genotypes originally evolved from genotype 1b. Virol J 2011;8:317.  Back to cited text no. 36
    
37.
Di Maio VC, Cento V, Mirabelli C, Artese A, Costa G, Alcaro S, et al. Hepatitis C virus genetic variability and the presence of NS5B resistance-associated mutations as natural polymorphisms in selected genotypes could affect the response to NS5B inhibitors. Antimicrob Agents Chemother 2014;58:2781-97.  Back to cited text no. 37
    
38.
Miller RH, Purcell RH. Hepatitis C virus shares amino acid sequence similarity with pestiviruses and flaviviruses as well as members of two plant virus supergroups. Proc Natl Acad Sci U S A 1990;87:2057-61.  Back to cited text no. 38
    
39.
Kolykhalov AA, Mihalik K, Feinstone SM, Rice CM. Hepatitis C virus-encoded enzymatic activities and conserved RNA elements in the 3' nontranslated region are essential for virus replication in vivo. J Virol 2000;74:2046-51.  Back to cited text no. 39
    
40.
Pan Q, Henry SD, Metselaar HJ, Scholte B, Kwekkeboom J, Tilanus HW, et al. Combined antiviral activity of interferon-alpha and RNA interference directed against hepatitis C without affecting vector delivery and gene silencing. J Mol Med (Berl) 2009;87:713-22.  Back to cited text no. 40
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04