Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1907 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (341 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~  References
 ~  Article Tables

 Article Access Statistics
    Viewed1951    
    Printed44    
    Emailed0    
    PDF Downloaded130    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
BRIEF COMMUNICATION
Year : 2018  |  Volume : 36  |  Issue : 3  |  Page : 426-428
 

The prevalence of occult hepatitis B infection among the blood donors in a tertiary care hospital, Puducherry


1 Department of Microbiology, JIPMER, Puducherry, India
2 Department of Transfusion Medicine, JIPMER, Puducherry, India

Date of Web Publication14-Nov-2018

Correspondence Address:
Dr. Rahul Dhodapkar
Department of Microbiology, JIPMER, Puducherry
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_18_32

Rights and Permissions

 ~ Abstract 

Occult hepatitis B infection (OBI) is a cause of concern while screening the blood donors to prevent transfusion-related transmission of infection. This study was conducted to assess the prevalence of OBI using total anti-HBc by ELISA and DNA detection by real time polymerase chain reaction (PCR). The samples included were negative for HBs Ag by ELISA. Out of 1102 samples tested, 156 were positive for total anti-hepatitis B core antigen and 52/156 by real-time PCR. Overall, the prevalence was found to be 4.71% (52/1102). The results indicate that nucleic acid-based testing should be an essential part of screening procedure to prevent missing of OBI.


Keywords: Blood donors, hepatitis B virus real-time polymerase chain reaction, occult hepatitis B infection, screening, total anti-hepatitis B core antigen


How to cite this article:
Athira K P, Vanathy K, Kulkarni R, Dhodapkar R. The prevalence of occult hepatitis B infection among the blood donors in a tertiary care hospital, Puducherry. Indian J Med Microbiol 2018;36:426-8

How to cite this URL:
Athira K P, Vanathy K, Kulkarni R, Dhodapkar R. The prevalence of occult hepatitis B infection among the blood donors in a tertiary care hospital, Puducherry. Indian J Med Microbiol [serial online] 2018 [cited 2019 Oct 23];36:426-8. Available from: http://www.ijmm.org/text.asp?2018/36/3/426/245390



 ~ Introduction Top


Screening the blood donors for the transfusion transmitted infections is utmost importance. The tests for Hepatitis B infection are a part of the screening tests employed along with other tests like HIV, hepatitis C virus (HCV), test for syphilis and malaria. Detection of hepatitis B infection is commonly done by performing ELISA to detect the surface antigen of serum Hepatitis B surface antigen (HBsAg) which is the first marker of hepatitis infection. However, there is a possibility of missing certain cases when a single test is employed for the detection of hepatitis B, this may be due to the infection being in incubation period or the presence of altered viruses such as mutants which do not express the surface antigen.[1] Occult hepatitis B infection (OBI) is a condition where persistence of hepatitis B virus (HBV) genomes in the hepatocytes of individuals testing negative for the HBsAg;[1] hence, these persons will show a negative result in a routine screening test for hepatitis B which is based on HBsAg. Recent literature has suggested the use of additional tests such as total anti-HBc screening and Hepatitis B DNA polymerase chain reaction (PCR) for screening the blood donors.[2] By this way, we can reduce the risk of blood recipient to get infected with occult hepatitis B. There has been drastic variation in the prevalence of occult hepatitis b infection in several studies; even studies from India have reported wide variation ranging from 0% to 50%.[3],[4],[5],[6],[7] Hence, we, in this study, would like to assess the prevalence of occult hepatitis B among the blood donors using standard screening tests.


 ~ Materials and Methods Top


This study was conducted in the Department of Transfusion Medicine and Microbiology from June 2015 to September 2016 in a tertiary care hospital. Proposal had gone through Institute Ethics Committee review and we requested for waiver for informed consent since samples were collected from the blood bank and not from the patient directly. Blood donor's samples which were tested negative for HBs Ag ELISA were included in the study. The donor's demographics excluding name and identity were recorded. The serum samples collected from blood bank are aliquoted in to properly labelled 2 ml Eppendorf tubes and stored at −20°C until it was processed. Total anti-HBc ELISA was done using commercially available kit (Autobio Diagnostics Co., Ltd. Zhengzhou, China) according to manufacturer's instructions. Following this, HBV Real-time DNA PCR targeting pre-core gene was performed using the kit from HELINI Biomolecules, Chennai, Tamil Nadu, India. It was performed on the Light cycler (Cobas Z 480, Roche) which is a TaqMan-based dual probe fluorescence assay using a final reaction mixture volume of 25 μl. The primers used were Forward = AGGAGGCTGTAGGCATAAATGC, Reverse = GCTCCAAATTCTTTATACGGGGG, Probe = ACTGTTCAAGCCTCCAAGCTGTGC. The amplification condition was Taq enzyme activation at 95°C - 15 min, 45 cycles of denaturation of 95°C - 20 s, annealing 56°C - 20 s, and extension 72°C - 20 s. The target samples were detected using FAM channel and internal control through the HEX channel.


 ~ Results Top


In our study, we had included totally 1102 blood donor samples which were seronegative for HBsAg, HCV, HIV, Venereal Disease Research Laboratory test. These donors presented to the Department of Transfusion medicine, as either voluntary or replacement donors during the study period from June 2015 to September 2016. The highest number of donors were in the age group of 20–50 years, n = 938 (85.11%). Below 20 years, it was n = 148 (13.43%) and above 50 years, n = 16 (1.45%). The highest number of donors was males 1066 (96.7%) when compared to female donors which was 36 (3.26%). In our study, the number of voluntary donors was 520 (47.1%) and as replacement donors were 582 (52.81%) which shows 5.1% increase in replacement donors than voluntary donors. The results of ELISA and PCR is given in [Table 1].
Table 1: Detection of occult hepatitis-B by ELISA, and real-time polymerase chain reaction

Click here to view



 ~ Discussion Top


The prevalence of occult hepatitis is differing in various geographical region. This wide variation in prevalence of OBI may have a serious impact on screening practices in blood Bank. Many blood banks use a combination of HBsAg and total anti-HBc as screening tools for hepatitis B infection. However, some studies had suggested that the incidence of true OBIs in anti-HBc seropositive is very low thus leading to high discard rate of blood.[8],[9]

In our study population, majority of donors were adults in the age group of 20–50 years due to increased risk of OBI in sexually active age and unsafe tattooing. In our study, the prevalence of OBI by total anti-HBc ELISA was 14.16%. This was similar to a study in India by Biswas et al.,[10] and Ismail et al.,[1] which was 12.2% and 16.7%, respectively whereas the study by Dhawan et al.,[8] and Panigrahi et al.,[11] showed 8.4% and 30%, respectively. These discrepancy in prevalence may be due to difference in sensitivity of screening tests for blood transfusion or due to the variability in the prevalence of hepatitis B in various parts of India. It was also found that 52 samples were tested positive in 156 of total anti-HBc positives showing an overall prevalence of 4.71% (52/1102) by real-time PCR. Globally, the prevalence of HBV DNA in anti-HBc positive blood donors were ranging from 2.95%,[10] 3.7%[12] and 7.5%[13] which were similar to our study and in contrast some studies showed high prevalence of 20.87%,[14] 21%.[15] This disparity in prevalence may be due to the variability in sensitivity and specificity of the test methods such as HBsAg ELISA and Total Anti-hepatitis B core antigen (HBcAg) ELISA used to detect the OBI or may be due to the difference in selection of subjects. The real-time PCR used in our study had a dynamic detection range of 10–10000 IU/μl. All the samples which tested positive by real time pcr were in the range of detected but not quantifiable. This indicates that all the samples had DNA levels in the range on ≤10 IU/μl.

The results of this study shown that approximately 4% of the HBsAg ELISA-negative samples had extremely low levels of HBV DNA and may plausibly lead to the transmission of HBV. We genotyped few representative samples in which we found five samples to be positive for genotype D, three for C, two for B and one for H.

However, the seropositivity for total anti HBc antibodies was approximately 14%, if we use a dual serologic testing of blood for screening, this would lead to discard rate of around 14% of blood. However, the HBV NAT results of our study have suggested that approximately 70% (104/156) of the anti HBc seropositive samples are negative for HBV DNA which precludes us to use anti-HBc ELISA routinely as false positive discard rates will be high.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 ~ References Top

1.
Ismail AM, Devakumar S, Anantharam R, Fletcher GJ, Subramani T, John GT, et al. Low frequency of occult hepatitis B infection in anti-HBc seropositive blood donors: Experience from a tertiary care centre in South India. Blood Transfus 2012;10:230-2.  Back to cited text no. 1
    
2.
Allain JP, Candotti D. Diagnostic algorithm for HBV safe transfusion. Blood Transfus 2009;7:174-82.  Back to cited text no. 2
    
3.
Kalantari H, Ferdowsi F, Yaran M. Prevalence of occult hepatitis B virus infection in hemodialysis patients in Isfahan, Iran. Adv Biomed Res 2016;5:151.  Back to cited text no. 3
[PUBMED]  [Full text]  
4.
Duseja A, Sharma S, Subramanian PG, Agnihotri SK, Chakraborti A, Chawla Y, et al. Occult hepatitis B virus (HBV) infection in healthy blood donors. Indian J Pathol Microbiol 2003;46:690-2.  Back to cited text no. 4
    
5.
Shetty K, Hussain M, Nei L, Reddy KR, Lok AS. Prevalence and significance of occult hepatitis B in a liver transplant population with chronic hepatitis C. Liver Transpl 2008;14:534-40.  Back to cited text no. 5
    
6.
Torbenson M, Thomas DL. Occult hepatitis B. Lancet Infect Dis 2002;2:479-86.  Back to cited text no. 6
    
7.
Sachdev S, Mittal K, Patidar G, Marwaha N, Sharma RR, Duseja AK, et al. Risk factors for transfusion transmissible infections elicited on post donation counselling in blood donors: Need to strengthen pre-donation counselling. Indian J Hematol Blood Transfus 2015;31:378-84.  Back to cited text no. 7
    
8.
Dhawan HK, Marwaha N, Sharma RR, Chawla Y, Thakral B, Saluja K, et al. Anti-HBc screening in Indian blood donors: Still an unresolved issue. World J Gastroenterol 2008;14:5327-30.  Back to cited text no. 8
    
9.
Makroo RN, Chowdhry M, Bhatia A, Arora B, Rosamma NL. Hepatitis B core antibody testing in Indian blood donors: A double-edged sword! Asian J Transfus Sci 2012;6:10-3.  Back to cited text no. 9
    
10.
Biswas A, Panigrahi R, Chandra PK, Banerjee A, Datta S, Pal M, et al. Characterization of the occult hepatitis B virus variants circulating among the blood donors from Eastern India. ScientificWorldJournal 2013;2013:212704.  Back to cited text no. 10
    
11.
Panigrahi R, Biswas A, Datta S, Banerjee A, Chandra PK, Mahapatra PK, et al. Anti-hepatitis B core antigen testing with detection and characterization of occult hepatitis B virus by an in-house nucleic acid testing among blood donors in Behrampur, Ganjam, Orissa in Southeastern India: Implications for transfusion. Virol J 2010;7:204.  Back to cited text no. 11
    
12.
Kleinman SH, Kuhns MC, Todd DS, Glynn SA, McNamara A, DiMarco A, et al. Frequency of HBV DNA detection in US blood donors testing positive for the presence of anti-HBc: Implications for transfusion transmission and donor screening. Transfusion 2003;43:696-704.  Back to cited text no. 12
    
13.
Asim M, Ali R, Khan LA, Husain SA, Singla R, Kar P, et al. Significance of anti-HBc screening of blood donors and its association with occult hepatitis B virus infection: Implications for blood transfusion. Indian J Med Res 2010;132:312-7.  Back to cited text no. 13
[PUBMED]  [Full text]  
14.
Chaudhuri V, Tayal R, Nayak B, Acharya SK, Panda SK. Occult hepatitis B virus infection in chronic liver disease: Full-length genome and analysis of mutant surface promoter. Gastroenterology 2004;127:1356-71.  Back to cited text no. 14
    
15.
Bhattacharya P, Chandra PK, Datta S, Banerjee A, Chakraborty S, Rajendran K, et al. Significant increase in HBV, HCV, HIV and syphilis infections among blood donors in West Bengal, Eastern India 2004-2005: Exploratory screening reveals high frequency of occult HBV infection. World J Gastroenterol 2007;13:3730-3.  Back to cited text no. 15
    



 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04