Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 602 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (929 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed557    
    Printed17    
    Emailed0    
    PDF Downloaded42    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 36  |  Issue : 1  |  Page : 65-69
 

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer


1 Division of Molecular Diagnostics, Microbiological Laboratory, 12A Cowley Brown Road, R.S.Puram, Coimbatore, Tamil Nadu, India
2 Department of Biotechnology, School of Biotechnology & Health Sciences, Karunya University, Karunya Nagar, Coimbatore, Tamil Nadu, India

Date of Web Publication2-May-2018

Correspondence Address:
Dr. Kootallur Narayanan Brahmadathan
Microbiological Laboratory, 12A Cowley Brown Road, R.S. Puram, Coimbatore - 641 002, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_17_342

Rights and Permissions

 ~ Abstract 

Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA) for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST) analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.


Keywords: Human chromosome 20, non-specific amplification, Streptococcus pneumoniae, SP LytA primer


How to cite this article:
Thangamony HH, Kumar R, Thangavelu CP, Mariappa M, Mariammal BV, Brahmadathan KN. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer. Indian J Med Microbiol 2018;36:65-9

How to cite this URL:
Thangamony HH, Kumar R, Thangavelu CP, Mariappa M, Mariammal BV, Brahmadathan KN. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer. Indian J Med Microbiol [serial online] 2018 [cited 2018 Sep 21];36:65-9. Available from: http://www.ijmm.org/text.asp?2018/36/1/65/231668



 ~ Introduction Top


Laboratory-developed in-house polymerase chain reaction (PCR) tests are meant to reduce cost without compromising on their sensitivity and specificity. Optimisation of such tests starts with the validation of selected primers by delineating various test characteristics including analytical specificity and sensitivity.[1] Normally, the specificity of the chosen primers is determined by testing them against genetically related and unrelated microbial pathogens as well as clinical material obtained from humans with diseases that may mimic the intended target for which the assay is being designed.[2] In general, primers that show such amplification are not chosen for designing PCR protocol; otherwise, strict optimisation should be implemented for those primers in the validation phase. In our early experiments with standardisation of high-resolution melt analysis (HRMA) for the molecular detection of Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis, SP LytA primer (chosen for S. pneumoniae) selected from a CDC protocol showed non-specific amplification with human DNA in wet laboratory experiments. This article describes the details of these observations and demonstrates how we were able to troubleshoot the problem and differentiate the melt curve of SP DNA from the human DNA amplicon.


 ~ Materials and Methods Top


HRMA was standardised using DNA extracted from S. pneumoniae (ATCC strain R 49619TM) obtained from the Division of Bacteriology, Microbiological Laboratory, Coimbatore, India, using Type-it HRM PCR kit (Qiagen, Hilden, Germany) in triplicates in Rotor-Gene Q Thermal Cycler.[3] The test was done according to the manufacturer's instructions. The primers used were SP LytA F373 (ACGCAATCTAGCAGATGAAGCA) and SP LytA R424 (TCGTGCGTTTTAATTCCAGCT)[4] and were obtained from Integrated DNA Technologies, Singapore. The programme for HRMA was followed as set in the software while the Ct values, endpoint fluorescence level and melting profile were assessed by HRMA software. The amplicon obtained from the ATCC SP strain was sent to Eurofins genomic Pvt Ltd, Bangalore, for sequencing to confirm the sequence of the primers. All sequencing reports were analysed through Gene Bank.

Melt or dissociation curve was generated after the completion of PCR by raising temperature from 65°C to 99°C with 0.1°C incremental order for 2 s each ramp rate in Rotor-Gene Q5plex real-time PCR machine with HRM capability. The normalised raw data by selecting linear regions before and after the melting transition and the derivative plot were generated by inbuilt HRMA software in the same Rotor-Gene Q5plex HRMA machine. To optimise the HRMA profile, the derived melt curve was assessed to check the purity of the product and primer dimer formation.[5]

The annealing temperature expected amplicon size and the predicted melt temperature (Tm) of the amplicon were calculated through Bioinformatics Tools of NEB Tm Calculator (version 1.9.4; New England Biolabs Inc.[https://www.neb.com/]), primer Basic Local Alignment Search Tool (BLAST) database (www.ncbi.nlm.nih.gov/tools/primer-blast/) and a free online Oligo Calc (version 2; Northwestern University, Chicago, IL [www.simgene.com]).

The specificity of the primers was determined in wet laboratory experiments against the bacterial, viral, fungal and protozoal pathogens listed in [Table 1]. For this, DNA extracted from diverse bacterial strains, cell culture positive for viral DNA or clinical samples positive for protozoal pathogens were subjected to HRMA as described earlier. Specificity was also tested by doing HRMA on DNA extracted from unspiked clinical samples including cerebrospinal fluid (CSF) (n = 21), blood/plasma (8), tissue (2) and Broncho-alveolar lavage fluid (2) that were negative for SP DNA.
Table 1: List of microbial species whose genomes were tested to check cross-reactivity of SPLytA primer in dry laboratory experiments

Click here to view


The sensitivity of the primers was determined in a spiked sample by calculating lower limit of detection threshold (LLT). For this, CSF samples (n = 21) negative for SP DNA were pooled and used as a single sample. From a known concentration of ATCC SP strain DNA (2.53 × 105 copies/ml using Qubit fluorometer), a series of 10-fold dilutions starting from 10−1 (25,300 copies/ml) through 10−7 (0 copies/ml) were made in Tris-EDTA buffer. From each dilution, 1 ml was taken and spiked into 200 μl of pooled CSF sample and subjected to extraction using Bioneer Accuprep genomic DNA extraction kit followed by amplification in Rotor-Gene Q. The last dilution giving amplification was taken as the endpoint. The LLT values were confirmed by repeating the testing of these dilutions in triplicates. Institutional ethical clearance was obtained for the use of above clinical samples as a part of the larger HRMA study.


 ~ Results Top


The dry laboratory data showed that the annealing temperature, expected amplicon length and the predicted Tm of SP LytA primer were 53°C, 75 bps and 75°C, respectively. Wet laboratory experiments showed that the amplification of SP DNA started at the 17th Ct cycle and its average Tm value based on three repeat testing was 77.3°C with a range of 77°C–78°C (data not given).

[Figure 1] shows the melt curves and Tm values of the 10-fold dilutions in the spiking experiment. The set of larger peaks with Tm values between 75°C and 78°C belonged to the SP DNA. The smaller peaks seen later in the Ct cycles had a peak melt temperature 80°C ± 0.1°C–0.9°C and appeared to indicate a non-specific amplification. This was confirmed by the spiking experiment done in 10-fold dilutions with the ATCC SP strain [Table 2]. The average Tm values of amplicons in dilutions 10−1 through 10−4 varied from 76.69°C to 76.70°C which corresponded to Ct cycles of 20.43–29.81 [Table 2]. In contrast, Tm values for dilutions 10−5 and 10−6 were >80°C at Ct cycles of >30. Thus, the presence of an amplicon with a higher Tm value and Ct cycle confirmed the existence of a second amplicon.
Figure 1: Melt graphs of target DNA and the non-specific amplicon in spiking experiment

Click here to view
Table 2: Ct cycle and Tm values of different dilutions of target DNA in the spiked experiments after amplification

Click here to view


To confirm that the amplification was non-specific, HRMA was carried out with unspiked human clinical specimens that were negative for SP DNA. Their amplification curves had Ct cycles of 30–32, while the Tm values varied from 81.62°C to 82.90°C. This showed that amplification occurred even in the absence of target DNA and with a higher Tm (data not shown).

The non-specific amplification was further confirmed by doing HRMA on three CSF samples reported positive for high, medium and low concentrations of SP DNA by a commercial kit (Fast Track Diagnostic Kit, IVD, Luxemburg, Germany).[6] The results showed that Ct values for the three samples were 10.30, 22.77 and 27.17, respectively, and Tm values were 78.55°C, 78.70°C and 78.90°C respectively [Figure 2]. There was only a single steep amplification curve in the high- and medium-positive samples, indicating relatively high concentrations of SP DNA, while two poorly formed curves were seen in the low-positive sample. The low-positive sample showed a peak starting at Ct cycle 27.17 with Tm values of 78.9°C and 83.30°C for SP and human DNA, respectively.
Figure 2: High-resolution melt analysis of cerebrospinal fluid samples positive for high-, medium-, and low-level SP DNA by Fast Track Diagnostic Kit

Click here to view


The original SP ATCC strain DNA amplicon could not be sequenced due to its small size (75 bp). Since the experiments with spiked samples showed two peaks, it was decided to sequence this amplicon. Presequencing gel had shown dispersed bands of different intensity revealing poor quality of the amplicon or some kind of cross-reaction (data not shown). The sequenced data were subjected to BLAST analysis which showed that the amplicon contained sequences of human chromosome 20 [Figure 3]a and [Figure 3]b, confirming similarity of certain sequences of human chromosome 20 to SP LytA primer. The sequence was found to be associated with Homo sapiens protein tyrosine phosphatase, receptor type T (PTPRT) gene on chromosome 20.
Figure 3: (a) Amplification of SP strain 122 autolysin gene by SP primer LytA (GenBank: KY581565.1). (b) SP LytA Primer cross-reactions with Homo sapiens protein tyrosine phosphatase, receptor type T (PTPRT), RefSeqGene on chromosome 20 (Sequence ID: NG_033880.1)

Click here to view



 ~ Discussion Top


The classical real-time PCR used for the laboratory diagnosis of infectious disease is costly for resource-crunch situations because it involves the use of a probe in the assay system. In recent times, this technique is being replaced by HRMA which is much cheaper, yet as rapid and sensitive as the classical PCR test.[7],[8],[9] Our article here describes a non-specific amplification of a human gene sequence by the CDC described SP LytA primer used for the detection of SP DNA in real-time PCR. This observation was confirmed with human samples without SP DNA and by sequencing the amplicon. The BLAST analysis showed that the cross-reaction was due to human chromosome 20 which is associated with H. sapiens protein tyrosine phosphatase, receptor type T (PTPRT) gene. Our results demonstrate the need to check for such non-specific amplifications when microbial primers are used for HRMA.

The initial suspicion of the non-specific amplification arose when the spiking experiments were conducted to determine the analytical specificity of the SP LytA primers. Amplification of the ATCC strain of SP showed two peaks, one before and another one after the 30th Ct cycle. In experiments set up with 10-fold dilutions in triplicates, dilutions up to 10-4 (up to 28.7 Ct cycle) gave a Tm value of 76.7°C, while dilutions from 10−5 (Ct cycles of 31–33) onward gave a Tm value of 81°C. Thus, two amplification peaks were observed with different Tm values at different Ct cycles. Subsequently, an unspiked experiment was done with five different types of clinical specimens that were negative for SP using the SP LytA primers. All clinical specimens tested gave amplification curves at Ct cycle of 31 and with Tm value of 82°C. These results confirmed the earlier results with the spiked samples, thereby establishing a cross-reactivity between SP LytA primer and an unidentified material of human origin. The amplified product was sent for sequencing, and the data obtained were analysed through BLAST analysis. The results showed that the cross-reactivity was due to a gene in human chromosome 20 that was identified as H. sapiens protein tyrosine phosphatase R type T. It is important to remember that the primer sequence was taken from a CDC protocol and in the natural course of events one would not have thought of such a cross-reaction. However, development of two amplification peaks with different Tm values made us suspect that there may be some problems with the primer sequences. This was found to be a non-specific amplification with a genetic locus of human chromosome number 20.

To confirm the nature of cross-reaction, HRMA was done on three CSF samples that yielded high, medium and low SP DNA load with a commercial kit [Figure 3]. HRMA done on these samples also gave high-, medium- and low-amplification curves; however, in the melt plot, the low-positive sample gave two peaks indicating that cross-reaction was observed only when the SP DNA load is relatively low. A possible explanation is that when SP DNA load is high, much of the master mix is used up for SP DNA amplification so that very little is left for the amplification of the cross-reacting human DNA. On the other hand, when the SP DNA load is low, little master mix is used up so that much of it is available for the amplification of human DNA during the later Ct cycles. In the clinical setting, such cross-reactions of the primers may not happen because of the presence of high DNA load in CSF samples of patients with acute pyogenic meningitis. However, DNA concentrations in clinical samples can vary, and therefore it is important to check for any possible primer cross-reactivity while standardising the PCR-HRMA protocol.

To the best of our knowledge, this is the first report of a non-specific amplification of a CDC developed primer, the SP LytA and a human genome. In an earlier report, Faria et al.[10] while standardising a profiling strategy to identify polymicrobial bacterial DNA in whole blood by 16S rRNA had alluded to sequences that amplified with human DNA as well. They also had referred to the low ratio of bacterial to host DNA as a major factor for such a cross-reaction. The problem was solved by deleting the cross-reacting sequences from the taxonomic profile. Such non-specific amplification of human DNA with universal 16S rRNA is well documented.[11],[12],[13],[14],[15],[16] Unlike the above studies, our study observed amplification of human genome with a specific primer used for the molecular detection of SP in CSF samples and not a broad range primer as the universal 16S rRNA. Clinical samples negative for SP may still contain pus cells and can give a false-positive result because it contains human genetic material. This is confirmed by our experiments with unspiked clinical samples that were negative for SP, yet gave amplification at a higher Ct cycle and higher Tm value. Our strategy to overcome the non-specific amplification was to stop the testing at the 30th Ct cycle in the HRMA system; beyond the 30th cycle, true amplification will not occur while any amplification beyond the 30th cycle will indicate a non-specific reaction. Our finding on the non-specific amplification may explain the high incidence of false-positive reactions being reported with S. pneumoniae in certain automated molecular diagnostic panels that may not use specific probes.[17],[18],[19] Such non-specific amplification will not occur in the classical real-time PCR system because the latter makes use of specific probes. We conclude that one must exclude non-specific amplifications while selecting primers for in-house standardisation of HRMA so that false-positive reactions do not interfere with the target identification in clinical samples.


 ~ Conclusion Top


Since HRMA is done without a specific probe, one should be aware of non specific amplifications while using primers for HRMA of human clinical samples. Appropriate corrective measures need to be taken before standardizing HRMA using such primers.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 ~ References Top

1.
Burd EM. Validation of laboratory-developed molecular assays for infectious diseases. Clin Microbiol Rev 2010;23:550-76.  Back to cited text no. 1
[PUBMED]    
2.
Belak S, Thorén P. Validation and quality control of polymerase chain reaction methods used for the diagnosis of infectious diseases. In: Barry ON, Bernard V, Steven E, Beverly S, Anatoly G, Mehdi EH, et al., editors. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: Mammals, Birds and Bees. Paris, France: Office International Des Epizooties; 2008. p. 46-55.  Back to cited text no. 2
    
3.
High Resolution Melt Analysis: Type-iT HRMTM PCR Handbook. Germany: Qiagen, Hilden; 2009.  Back to cited text no. 3
    
4.
Leonard M, Dana C, Brian H, Cynthia H, Michael J, Lee K, et al. PCR for Detection and characterization of bacterial meningitis pathogens: Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae, p105-156. In: Bernard B, Rasmata O, Thomas C, Fem JP, Tanja P, Amanda C, et al., editors. Laboratory Methods for the Diagnosis of Meningitis Caused by Neisseria Meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. Geneva, Switzerland: WHO Press; 2011. p. 105-6.  Back to cited text no. 4
    
5.
Nan F. Rotor-Gene Q – Pure Detection, High Resolution Melting, From Assay to Analysis: Instruction Manual. Germany: Qiagen, Hilden; 2011.  Back to cited text no. 5
    
6.
Fast Track Diagnostics. Bacterial meningitis. In: Instruction Manual. Luxembourg: Fast Track Diagnostics; 2016.  Back to cited text no. 6
    
7.
Yang S, Ramachandran P, Rothman R, Hsieh YH, Hardick A, Won H, et al. Rapid identification of biothreat and other clinically relevant bacterial species by use of universal PCR coupled with high-resolution melting analysis. J Clin Microbiol 2009;47:2252-5.  Back to cited text no. 7
[PUBMED]    
8.
Ozbak H, Dark P, Maddi S, Chadwick P, Warhurst G. Combined molecular gram typing and high-resolution melting analysis for rapid identification of a syndromic panel of bacteria responsible for sepsis-associated bloodstream infection. J Mol Diagn 2012;14:176-84.  Back to cited text no. 8
[PUBMED]    
9.
Tong SY, Giffard PM. Microbiological applications of high-resolution melting analysis. J Clin Microbiol 2012;50:3418-21.  Back to cited text no. 9
[PUBMED]    
10.
Faria MM, Conly JM, Surette MG. The development and application of a molecular community profiling strategy to identify polymicrobial bacterial DNA in the whole blood of septic patients. BMC Microbiol 2015;15:215.  Back to cited text no. 10
    
11.
Edwards U, Rogall T, Blöcker H, Emde M, Böttger EC. Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res 1989;17:7843-53.  Back to cited text no. 11
    
12.
Bosshard PP, Zbinden R, Altwegg M. Turicibacter sanguinis gen. Nov. sp. Nov. a novel anaerobic, gram-positive bacterium. Int J Syst Evol Microbiol 2002;52:1263-6.  Back to cited text no. 12
    
13.
De Vlaminck I, Khush KK, Strehl C, Kohli B, Luikart H, Neff NF, et al. Temporal response of the human virome to immunosuppression and antiviral therapy. Cell 2013;155:1178-87.  Back to cited text no. 13
[PUBMED]    
14.
Kommedal Ø, Simmon K, Karaca D, Langeland N, Wiker HG. Dual priming oligonucleotides for broad-range amplification of the bacterial 16S rRNA gene directly from human clinical specimens. J Clin Microbiol 2012;50:1289-94.  Back to cited text no. 14
    
15.
Maitra SS, Kumar B, Ghosh SK, Tiwary BK. Ross-reactivity of prokaryotic 16s rRNA gene-specific primers with genomes from Eukaryotic organisms from Marshlands. J Biol Nat 2015;2:58-68.  Back to cited text no. 15
    
16.
Huys G, Vanhoutte T, Joossens M, Mahious AS, De Brandt E, Vermeire S, et al. Coamplification of eukaryotic DNA with 16S rRNA gene-based PCR primers: Possible consequences for population fingerprinting of complex microbial communities. Curr Microbiol 2008;56:553-7.  Back to cited text no. 16
[PUBMED]    
17.
Hanson KE. The first fully automated molecular diagnostic panel for meningitis and encephalitis: How well does it perform, and when should it be used? J Clin Microbiol 2016;54:2222-4.  Back to cited text no. 17
[PUBMED]    
18.
Leber AL, Everhart K, Balada-Llasat JM, Cullison J, Daly J, Holt S, et al. Multicenter evaluation of bioFire filmArray meningitis/Encephalitis panel for detection of bacteria, viruses, and yeast in cerebrospinal fluid specimens. J Clin Microbiol 2016;54:2251-61.  Back to cited text no. 18
[PUBMED]    
19.
Hanson KE, Slechta ES, Killpack JA, Heyrend C, Lunt T, Daly JA, et al. Preclinical assessment of a fully automated multiplex PCR panel for detection of central nervous system pathogens. J Clin Microbiol 2016;54:785-7.  Back to cited text no. 19
[PUBMED]    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04