Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 635 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (554 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed940    
    Printed25    
    Emailed0    
    PDF Downloaded175    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 36  |  Issue : 1  |  Page : 26-31
 

Molecular characterisation of Staphylococcus aureus using spa typing as a diagnostic tool in Haryana, India


Department of Microbiology, Faculty of Medicine and Health Sciences, SGT University, Gurgaon, Haryana, India

Date of Web Publication2-May-2018

Correspondence Address:
Dr. Gurjeet Singh
Department of Microbiology, Faculty of Medicine and Health Sciences, SGT University, Gurgaon, Haryana
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_17_330

Rights and Permissions

 ~ Abstract 

Background: Staphylococcus aureus is one of the top six most common etiologic agents of nosocomial, community and livestock acquired bacterial infections. These infections although initially were described as a major problem in hospitals have now also become a serious threat in community not only in India but also worldwide. Its prevalence varies depending on the health-care setting, country or a particular region. Thus to better understand the epidemiology of methicillin-resistant S. aureus (MRSA) in a particular geographical location, it is important to study the variations in the population using molecular tools. Methods: This prospective study was carried out in the Department of Microbiology of Shree Guru Gobind Singh Tricentenary (SGT) Medical College. Staphylococcal protein A (spa) typing was done on 250 S. aureus isolates obtained from various clinical specimens including pus, wound swabs, urine, catheters, blood and cerebrosspinal fluid from both indoor and outdoor patients of SGT Hospital, Budhera, Gurgaon. Results: The selected region of the spa gene of all 250 isolates which includes 87 MRSA and 163 methicillin-susceptible S. aureus were amplified. The spa gene was detected in 248 out of 250 isolates (99.2%), whereas in 2 isolates (0.8%), it remained undetected and referred as non-typable isolates. The 248 S. aureus isolates were typed into 39 spa types, which clustered into six different spa clonal clusters and eight singletons. Conclusion: High diversity observed within S. aureus isolates indicated that many different strains circulate in the study region or in the hospital. The results would contribute in the understanding of epidemiology related to S. aureus spread and prevention.


Keywords: Based on repeat pattern analysis, Haryana, spa typing, Staphylococcus aureus


How to cite this article:
Singh G, Broor S, Agarwal P. Molecular characterisation of Staphylococcus aureus using spa typing as a diagnostic tool in Haryana, India. Indian J Med Microbiol 2018;36:26-31

How to cite this URL:
Singh G, Broor S, Agarwal P. Molecular characterisation of Staphylococcus aureus using spa typing as a diagnostic tool in Haryana, India. Indian J Med Microbiol [serial online] 2018 [cited 2018 Nov 15];36:26-31. Available from: http://www.ijmm.org/text.asp?2018/36/1/26/231667



 ~ Introduction Top


Staphylococcus aureus is one of the top six most common etiologic agents in humans of nosocomial, community and livestock acquired infections worldwide. S. aureus can infect many areas of the body including skin, mucus membranes and blood stream infections, etc.[1],[2],[3] S. aureus has remarkable ability to acquire resistance to antimicrobial agents, especially methicillin. Methicillin-resistant S. aureus(MRSA) often referred as super bugs, is a resistant variant of S. aureus, with an ability to survive against β-lactam antibiotics such as penicillin, methicillin, cephalosporin and various other groups of antimicrobial agents.[4],[5] Due to the increasing resistance to antimicrobial agents causing treatment failure, it is now considered as a major public health concern. Glycopeptides such as vancomycin is the preferred drug of choice for treatment of MRSA infections.[6] The resultant selective pressure has led to the emergence of vancomycin-resistant S. aureus strains.[7],[8]

Considerable variations in the prevalence of MRSA have been reported in the literature according to different geographic areas of the world.[9] The European Centre for Disease Prevention and Control also reported significant variations in the prevalence of MRSA from <5% in Northern European countries to more than 25% in Southern and Eastern European countries (ECDC).[10] The prevalence of MRSA in India varies from 80.89% in Indore in the year 1999[11] to 31.1% in Tamil Nadu in 2006[12] and 38.44% in Varanasi during 2008.[13] These differences in the data may be due to the differential clonal expression, regional disparity and antibiotic pressure in the community. Further reports of multi-drug resistance among MRSA infections are suggestive of a serious emerging threat in India which is alarming and may soon become a global problem unless antibiotic agents are used more prudently.[12],[13],[14] The higher frequency rate of MRSA within a particular geographical area was shown to be a reflection of successful spread of one or several clones, and this varies depending on the health-care setting, country or region.[1] Furthermore, the variations within clones are observed even within a particular region with some increasing in number and some fading away.[15]

Thus to better understand the epidemiology of MRSA in a particular geographical location, it is important to study its population structure using molecular tools which helps in identifying the genetic diversity of the pathogen, its evolutionary pathways along with clonal population and tracking the spread of S. aureus infections.[16] Reliable molecular tools for typing S. aureus phylogeny are pulsed-field gel electrophoresis (PFGE), staphylococcus cassette chromosome (SCCmec) typing, multilocus sequence typing (MLST) and staphylococcal protein A (spa) gene typing.[17] PFGE is considered as the gold standard for strain characterisation and is widely used to identify outbreaks and for short-term local epidemiology.[1],[18] The major disadvantage of this method is however difficult to compare PFGE patterns due to low portability of the data among different centers along with regional description of its patterns.[19] SCCmec typing uses a defined nomenclature but there are several typing and subtyping schemes in this method that sometimes may not be harmonized easily. MLST involves sequencing of seven housekeeping genes and isolates showing sequence similarity in all seven genes are given a unique sequence type (ST) number. The closely related STs are grouped together into a single clonal complex (CC).[20],[21] MLST is highly discriminatory and widely accepted technique for typing of S. aureus and MRSA epidemiology, but sequencing of seven genes makes this an expensive and time-consuming method. Therefore, many epidemiological studies have used spa typing, a method based on the sequencing of polymorphic X region of spa gene. The spa gene consists of the different functional region, including the Fc binding region that confers binding to the cell wall and polymorphic X region made of a variable number of 24-bp repeat fragments. These repeat fragments are assigned a numerical code and the spa type is deduced from the order of specific repeats.[22] Further, an algorithm named based on repeat pattern (BURP) is then used to group various spa types into spa-CCs. Thus, spa typing, unlike MLST and PFGE, can be used to study both the molecular evolution and hospital outbreaks because it is least tedious, less expensive and less time consuming among all the previously described methods.[23] In Canada, based on observed concordance of spa types with MLST and PFGE, the feasibility of spa typing for Canadian MRSA strains has been demonstrated as a more expedite and less technically demanding alternative typing method.[24],[25]

Unfortunately, the molecular epidemiology of S. aureus is not well described in India. A handful of studies on the molecular characterization of S. aureus isolates in India are done based on SCCmec typing and MLST typing and that too are only on MRSA isolates. This study is the first report on methicillin-susceptible S. aureus (MSSA) and MRSA population structure and various clones present in the study area by spa typing method. It was conducted to better understand the S. aureus phylogeny by spa typing in combination with BURP analysis. The major strength of this study is that it was conducted on the S. aureus isolates from both indoor and outdoor patients. To the best of our knowledge, this is probably the first largest study of molecular epidemiology of S. aureus by spa typing in Haryana, India.


 ~ Materials and Methods Top


This study was conducted from April 2015 to May 2016 and was approved by the ethics committee (Ref. letter SGTU/FMS/D/209) of Shree Guru Gobind Singh Tricentenary (SGT) University, Budhera, Gurgaon. A total of 250 S. aureus isolates from various clinical specimens including pus, wound swabs, urine, catheters, blood and cerebros-spinal fluid from both indoor and outdoor patients of SGT Hospital, Budhera, Gurgaon were included in the present study. Identification of S. aureus was based on the standard methods such as Gram staining, catalase, mannitol fermentation, slide and tube coagulase tests.[26] The susceptibility testing to cefoxitin was performed to identify methicillin resistance with Kirby-Bauer disc diffusion method according to CLSI guidelines.[27] All isolates of S. aureus were subjected to a multiplex real-time polymerase chain reaction (PCR) for Staphylococcus protein A gene (spa) and methicillin resistance gene (mecA).[28]

Spa typing

The spa typing was performed by PCR using primers (designed by us) as described below.

DNA preparation and extraction

Overnight culture (100 μl) was pelleted at 12,000 rpm and washed thrice with distilled water. Washed pellet was suspended in Tris-ethylenediaminetetraacetic acid (EDTA) buffer and incubated in boiling water for 10 min for culture inactivation. Post inactivation the cells in the suspension were lysed with mechanical bead beater using 0.1 mm zirconia-silica beads at 15,000 rpm for 2 min. The lysate was then centrifuged at 12,000 rpm for 10 min. The supernatant was transferred to a separate tube and further purified using Qiagen blood mini kit (Qiagen, Germany) following protocol for body fluids as described by the manufacturer. The purified DNA was quantified using Nanodrop spectrophotometer (Thermo, USA).

Primer designing

The variable repeats region of spa gene was manually selected and used as input in Primer 3 software (Sourceforge: primer3.sourceforge.net/. Developed by Steve Rozen and Helen Skaletsky) and run using default parameters. The resultant primers were further screened manually using Gene runner software version 3.05 (Hastings Software Inc. Hastings, USA)for the best primer pair, devoid of secondary structures. The primers were then filtered for their specificities using NCBI Blast program, with a filter of delta E value ≤0.1.

Polymerase chain reaction amplification

Bacterial DNA (2 μl of 100 ng/μl) was used to constitute 25 μl PCR reaction containing 1U (0.2 μl) AmpliTaq (Thermo, USA), 1 × (2.5 μl) AmpliTaq buffer (Thermo, USA), 200 μM (0.5 μl) dNTP (Thermo, USA), 1.5 mM (1.5 μl) MgCl2 (Thermo, USA) and 500 nM (1.25 μl) each of forward (TTAGCATCTGCATGGTTTGC) (spa position 123–143) and reverse primers (CAAGCACCAAAAGCTGACAA) (spa position 713–723) (Bio Serve, India) and made up with nuclease free water. The reaction was performed in a T100 thermocyclar (Bio-Rad, USA) with thermal profile: Initial denaturation at 96°C for 3 min and 35 cycles of denaturation 96°C for 30 s; annealing at 58°C for 30 s and extension at 72°C for 60 s and final extension at 72°C for 7 min. Post PCR the reaction mixture was checked for amplification on 1% Agarose gel for standardization. The PCR products were further purified to remove unincorporated primers and dNTPs using EXOSAP enzyme (NEB, UK) as per manufacturer's instructions.

Sequencing

Purified PCR products were quantified using Nanodrop spectrophotometer (Thermo, USA) and 10–15 ng product was used to constitute a 10 μl sequencing reaction containing Big Dye Terminator (ABI), 1x sequencing buffer, 3.2 pM forward primer. The reaction was incubated in a T100 thermocycler (Bio Red, USA) using the following parameters: 96°C for 1 min, 25 cycles of 96°C for 10 s, 55°C for 5 s, 60°C for 4 min. The reactions were purified by precipitation using 1/10th volume 3M sodium acetate and 1/10th volume 125 mM EDTA and 2.5 volumes absolute alcohol and pelleted by spinning at 13,500 rpm for 20 min. The pellet was washed twice using 80% alcohol and finally airdried. The pellets were dissolved in 20 μl Hi-Di formamide and were further incubated in a thermocycler at 96°C for 2 min and snap chilled. The prepared sequencing products were sequenced in ABI Genetic analyzer 3500 as per manufacturer's instructions at Lab Banaras, Varanasi.

Analysis

The raw chromatograms were initially viewed using chromas software and edited manually if required. The edited files were spa typed using BioNumerics software version 7.6 (Applied Maths. Keistraat 120, 9830 Sint-Latem, Balgium).


 ~ Results Top


The spa gene was detected in 248 out of 250 isolates (99.2%), whereas in 2 isolates (0.8%), it remains undetected and referred as non-typeable isolates. These two isolates were of methicillin-resistant type. In 248 spa genes positive isolates, PCR resulted in amplicons ranging from size 400–700 bp. The nucleotide sequences of 248 spa positive amplicons were sequenced and typed into the various spa types using BioNumerics software version 7.6 (Keistraat 120, 9830 Sint-Latem, Balgium) from Applied Maths. The nucleotides sequence analysis of 248 isolates resulted in 39 distinct spa types. There were 29 MRSA isolates which had 9 unique spa types i.e., t037 (n = 6), t045 (n = 6), t9493 (n = 3), t1360 (n = 3), t4333 (n = 3), t2518 (n = 2), t1921 (n = 2), t979 (n = 2) and t1939 (n = 2). Whereas 20 spa types were unique to 103 MSSA isolates i.e., t127 (n = 24), t3841 (n = 22), t442 (n = 9), t091 (n = 9), t1839 (n = 8), t223 (n = 4), t9456 (n = 4), t6769 (n = 3), t1298 (n = 2), t1642 (n = 2), t098 (n = 2), t314 (n = 2), t2663 (n = 2), t3204 (n = 2), t13881 (n = 2), t315 (n = 2), t1234 (n = 1), t15364 (n = 1), t2526 (n = 1) and t458 (n = 1). There were 10 spa types which were present in both MRSA and MSSA isolates (n = 56 MRSA and n = 60 MSSA) i.e., t021 (n = 13 MRSA and n = 22 MSSA), t657 (n = 13 MRSA and n = 10 MSSA), t1149 (n = 3MRSA and n = 12 MSSA), t309 (n = 6 MRSA and n = 4 MSSA), t005 (n = 6 MRSA and n = 2 MSSA), t14090 (n = 4 MRSA and n = 2 MSSA), t902 (n = 2 MRSA and n = 3 MSSA), t2085 (n = 2 MRSA and n = 3 MSSA), t852 (n = 4 MRSA and n = 1 MSSA) and t345 (n = 3 MRSA and n = 1 MSSA). The distribution of various spa types among S. aureus is shown in [Figure 1]. The accession numbers of our registered 39 gene sequence in NCBI Gene Bank are KY123187-90, KY084255-60 and KY110967-95.
Figure 1: Distribution of various spa types among Staphylococcus aureus isolates

Click here to view


These spa types were clustered into different cluster groups by BURP algorithm that is installed in RidomStaph type software. BURP algorithm assigned various spa types as spa CCs (spa-CC), no founders, singletons or excluded spa type. The 248 spa types in this study have been assigned 5 spa CCs (spa-CC005, spa-CC1298, spa-CC3841, spa-CC 2526 and spa-CC345), 1 group with no founders, 8 singletons and 3 excluded spa types. The three spa types excluded from the clustering parameters analysis are with repeats shorter than five, as the length of these repeat patterns were insufficient to deduct evolutionary history from these spa types. The dimension of the cluster were defined by implementing a value ≤6 as the clustered cost between members of a group.[24] The spa-CC, spa type, no. of total strains, MRSA and MSSA strains and repeat IDs for 248 isolates are given in [Table 1]. Graphical representation of the relationship of spa types in cluster group one to six is shown in [Figure 2].
Table 1: The spa clonal complexes, spa type, number of total strains, methicillin-resistant Staphylococcus aureus and methicillin-susceptible Staphylococcus aureus strains and repeat IDs for 248 isolates

Click here to view
Figure 2: Graphical representation of the relationship of spatypes in cluster group one to six. Founders of each of these cluster groups are colored blue, whereas sub-founders are colored yellow. The size of each spatype node refers to the number of clustered strains belonging to each specific spatype

Click here to view



 ~ Discussion Top


S. aureus infections, particularly MRSA are becoming a major health issue in India. One major reason is steadily increasing occurrence of MRSA strains in the hospitals.[29] However, the epidemiology and population diversity of MRSA and MSSA strains still remained to be elucidated. Various studies on MRSA and MSSA strains from different parts of the world have reported great diversity, which suggests that many different strains are circulating in particular hospitals or region.[30],[31] Surveillance programmes combined with the dedicated typing method should be performed to better understand the dimension of the problem and particular strains circulating in the region. The various spa types can evolve due to insertions, deletions or duplications of an individual repeat unit or group of repeats or point mutations within a specific repeat unit, leading to the formation of a different repeat unit. Faria et al.[24] used spa, MLST and PFGE methods to type 116 MRSA isolates and reported the isolation of 51, 34 and 32 types by these methods respectively indicating that discriminatory power of spa typing is more powerful than MLST and PFGE. Although, there are few reports from different parts of India on MLST and SCCmec typing, but none of them has reported the prevalence of spa type in their area comprehensively. Our study is based on the finding of Baum et al.,[32] Faria et al.[24] and Mellmann et al.[22] and designed to show the combined effects of spa typing and BURP analysis from spa repeat regions which infersclonal relatedness and assigns phylogenetic relationship among various S. aureus strains.

Typing of spa gene of MRSA strains by PCR-RFLP method was attempted in India where the researcher could report only five spa types [29] but in the present study, using spa typing method, we could detect 39spa types which were clustered into six different groups and eight singletons by BURP analysis. Our findings are in accordance with the report of Shakeri, and Ghaemi [33] in Iran where they reported 50spa types from 182 S. aureus isolates by spa typing method, whereas only 8 spa types were reported by a PCR-RFLP method in 191 S. aureus isolates. This suggests that spa typing method has better discriminatory effects than PCR-RFLP spa typing method.

The most prevalent spa type among S. aureus as well as MRSA isolates in our area was t021 (35/248 [14.1%] among S. aureus isolates and 13/85 [15.3%] among MRSA isolates). It was also seen in 22/163 (13.5%) of MSSA isolates. The second most prevalent spa type was t127 (24/248 [9.6%]) which was only seen among MSSA isolates. This was followed by spa types t657 (23/248 [9.2%]), t3841 (22/248 [8.8%]), t1149 (15/248 [6.0%]) and t309 (10/248 [4.0%]). Shakeri and Ghaemi [33] reported spa type t037 and t937 were the most common among S. aureus isolates in North of Iran. Bazzoun et al.[34] reported that spa type t044 was the most common among isolates from Amman-Jordan representing 38% of the MRSA population and 28% of the S. aureus isolates. Another study by Harastani et al.[35] from Lebanon reported spa type t021, t044and t267 as the most common among S. aureus isolates. The most prevalent spa types in our study, i.e., t021 (spa-CC 1298), t127 (No founder), t657 (spa-CC345), t3841 (spa-CC 3841), t1149 (singletons), and t309 (spa-CC 005) all belong to different spa-CC. It is worth mentioning that spa-CC 005, spa-CC 1298, spa-CC 3841, spa-CC 2526 and spa-CC345 contained more than one spa type and included both MRSA and MSSA isolates. These clonal complexes including both MRSA and MSSA strains could be indicative of the extension of MRSA from MSSA through the acquisition of SCCmec elements.[23] Although studies from different parts of the world have shown that spa types and spa-CC vary in different regions, no such comprehensive data on spa typing and BURP analysis of MRSA and MSSA isolates from patient's is available from different cities or hospitals in India. It would be interesting to see similar studies from other parts of India, which will give a clearer and better understanding of epidemiology and population structure of MRSA and MSSA isolates in India.

spa typing method has been used in other parts of the world as well and is a valuable tool for characterization of S. aureus isolates. Recently, Khademi et al.[36] used spa typing and BURP analysis to type 56 S. aureus isolates in Mashhad, Iran and revealed 24 different spa types which clustered into five spa-CC and 12 singletons with spa- CC 024 being the most common among isolates (37.5%). A similar study from Iran reported 13 distinct spa types in 100 MRSA isolates that further clustered into four groups.[37] In another study from Amman, Jordon revealed 14 spa types in 19 MSSA isolates, and 18 spa types in 41 MRSA isolates with spa type t044 and t037 being the most common, which were clustered into two spa-CC (spa-CC 044 and spa- CC 037), eight singletons and three groups with no founder in BURP algorithm.[34] Similarly, Tokajian et al.[31] in their study of spa typing 137 S. aureus clinical isolates in Lebanon (93 MRSA and 37 MSSA) assigned 48 different spa types clustering into 23 different groups with 12 singletons and 11 groups comprising more than one spa types. We, therefore, adopted spa typing method for characterization of 250 S. aureus isolates in this study and propose this to be a very useful tool.

Previous studies have reported the high diversity in the genetic profile of MSSA as compared to MRSA isolates. Interestingly, we could not find any significant difference in the distribution of spa types among MRSA (19 types) and MSSA isolates (30 types) which do not match with the previous reports by Bazzoun et al.,[34] Grundmann et al.[30] and Strommenger et al.[38] where they reported high diversity in the genetic profile of MSSA compare to MRSA isolates. Further, here we detected nine spa types unique to MRSA isolates and twenty spa types were unique to MSSA isolates. Any possibility of a relationship of methicillin sensitivity with various spa types of S. aureus isolates needs to be studied in larger population from other parts of India.


 ~ Conclusion Top


The study finding was based on spa typing in combination with BURP analysis on S. aureus isolates that is lacking in the area of study. The S. aureus isolates were typed into 39 spa types, which again were clustered into six different spa clonal clusters and 8 singletons. The high diversity observed within S. aureus isolates indicated that many different strains circulate in the study region or in the hospital. Moreover, the spa typing in combination with BURP analysis could be a better alternative than other methods for characterization of S. aureus isolates. However, this needs further validation from different hospitals and cities in India.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 ~ References Top

1.
Basset P, Nübel U, Witte W, Blanc DS. Evaluation of adding a second marker to overcome Staphylococcus aureus spa typing homoplasies. J Clin Microbiol 2012;50:1475-7.  Back to cited text no. 1
    
2.
Lamers RP, Stinnett JW, Muthukrishnan G, Parkinson CL, Cole AM. Evolutionary analyses of Staphylococcus aureus identify genetic relationships between nasal carriage and clinical isolates. PLoS One 2011;6:e16426.  Back to cited text no. 2
[PUBMED]    
3.
Labandeira-Rey M, Couzon F, Boisset S, Brown EL, Bes M, Benito Y, et al. Staphylococcus aureus panton-valentine leukocidin causes necrotizing pneumonia. Science 2007;315:1130-3.  Back to cited text no. 3
[PUBMED]    
4.
Grema HA, Geidam YA, Gadzama GB, Ameh JA, Suleiman A. Methicillin resistant Staphylococcus aureus(MRSA): A review. Adv Anim Vet Sci 2015;3:79-98.  Back to cited text no. 4
    
5.
Harbarth S, Hawkey PM, Tenover F, Stefani S, Pantosti A, Struelens MJ, et al. Update on screening and clinical diagnosis of meticillin-resistant Staphylococcus aureus(MRSA). Int J Antimicrob Agents 2011;37:110-7.  Back to cited text no. 5
    
6.
Tiwari HK, Sen MR. Emergence of vancomycin resistant Staphylococcus aureus(VRSA) from a tertiary care hospital from Northern part of India. BMC Infect Dis 2006;6:156.  Back to cited text no. 6
[PUBMED]    
7.
Walsh TR, Howe RA. The prevalence and mechanisms of vancomycin resistance in Staphylococcus aureus. Annu Rev Microbiol 2002;56:657-75.  Back to cited text no. 7
[PUBMED]    
8.
Tsuji BT, Rybak MJ. Etest synergy testing of clinical isolates of Staphylococcus aureus demonstrating heterogeneous resistance to vancomycin. Diagn Microbiol Infect Dis 2006;54:73-7.  Back to cited text no. 8
[PUBMED]    
9.
Stefani S, Chung DR, Lindsay JA, Friedrich AW, Kearns AM, Westh H, et al. Methicillin-resistant Staphylococcus aureus(MRSA): Global epidemiology and harmonization of typing methods. Int J Antimicrob Agents 2012;39:273-82.  Back to cited text no. 9
[PUBMED]    
10.
European Centre for Disease Prevention and Control. Annual Epidemiological Report 2012. Reporting on 2010 Surveillance Data and 2011 Epidemic Intelligence Data. Stockholm, ECDC; 2013.  Back to cited text no. 10
    
11.
Verma S, Joshi S, Chitnis V, Hemwani N, Chitnis D. Growing problem of methicillin resistant staphylococci – Indian scenario. Indian J Med Sci 2000;54:535-40.  Back to cited text no. 11
[PUBMED]  [Full text]  
12.
Rajaduraipandi K, Mani KR, Panneersevam K, Mani M, Bhaskar M, Manikandan P. Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: A multicenter study. Indian J Med Microbiol 2006;24:34-8.  Back to cited text no. 12
[PUBMED]  [Full text]  
13.
Tiwari HK, Sapkota D, Sen MR. High prevalence of multidrug-resistant MRSA in a tertiary care hospital of Northern India. Infect Drug Resist 2008;1:57-61.  Back to cited text no. 13
[PUBMED]    
14.
Saha B, Singh AK, Ghosh A, Bal M. Identification and characterization of a vancomycin-resistant Staphylococcus aureus isolated from Kolkata (South Asia). J Med Microbiol 2008;57:72-9.  Back to cited text no. 14
[PUBMED]    
15.
Blanc DS, Petignat C, Wenger A, Kuhn G, Vallet Y, Fracheboud D, et al. Changing molecular epidemiology of methicillin-resistant Staphylococcus aureus in a small geographic area over an eight-year period. J Clin Microbiol 2007;45:3729-36.  Back to cited text no. 15
[PUBMED]    
16.
Tokajian S. New epidemiology of Staphylococcus aureus infections in the Middle East. Clin Microbiol Infect 2014;20:624-8.  Back to cited text no. 16
[PUBMED]    
17.
Falagas ME, Karageorgopoulos DE, Leptidis J, Korbila IP. MRSA in Africa: Filling the global map of antimicrobial resistance. PLoS One 2013;8:e68024.  Back to cited text no. 17
[PUBMED]    
18.
Chua KY, Seemann T, Harrison PF, Monagle S, Korman TM, Johnson PD, et al. The dominant Australian community-acquired methicillin-resistant Staphylococcus aureus clone ST93-IV [2B] is highly virulent and genetically distinct. PLoS One 2011;6:e25887.  Back to cited text no. 18
[PUBMED]    
19.
Cookson BD, Robinson DA, Monk AB, Murchan S, Deplano A, de Ryck R, et al. Evaluation of molecular typing methods in characterizing a European collection of epidemic methicillin-resistant Staphylococcus aureus strains: The HARMONY collection. J Clin Microbiol 2007;45:1830-7.  Back to cited text no. 19
[PUBMED]    
20.
Abdulgader SM, Shittu AO, Nicol MP, Kaba M. Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Africa: A systematic review. Front Microbiol 2015;6:348.  Back to cited text no. 20
[PUBMED]    
21.
Chatterjee SS, Otto M. Improved understanding of factors driving methicillin-resistant Staphylococcus aureus epidemic waves. Clin Epidemiol 2013;5:205-17.  Back to cited text no. 21
[PUBMED]    
22.
Mellmann A, Weniger T, Berssenbrügge C, Keckevoet U, Friedrich AW, Harmsen D, et al. Characterization of clonal relatedness among the natural population of Staphylococcus aureus strains by using spa sequence typing and the BURP (based upon repeat patterns) algorithm. J Clin Microbiol 2008;46:2805-8.  Back to cited text no. 22
    
23.
Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol 2008;8:747-63.  Back to cited text no. 23
[PUBMED]    
24.
Faria NA, Carrico JA, Oliveira DC, Ramirez M, de Lencastre H. Analysis of typing methods for epidemiological surveillance of both methicillin-resistant and methicillin-susceptible Staphylococcus aureus strains. J Clin Microbiol 2008;46:136-44.  Back to cited text no. 24
[PUBMED]    
25.
Golding GR, Campbell JL, Spreitzer DJ, Veyhl J, Surynicz K, Simor A, et al. A preliminary guideline for the assignment of methicillin-resistant Staphylococcus aureus to a Canadian pulsed-field gel electrophoresis epidemic type using spa typing. Can J Infect Dis Med Microbiol 2008;19:273-81.  Back to cited text no. 25
[PUBMED]    
26.
Colle JG, Miles RS, Watt B. Test for the identification of bacteria. In: Collee JG, Fraser AG, Marmion BP, Simmons A, editors. Mackie and McCartney Practical Medical Microbiology. 14th ed. Edinburgh: Churchill Livingstone; 1996. p. 131-50.  Back to cited text no. 26
    
27.
Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Fourth Informational Supplement. Technical Report M100-S24. Wayne, Pa, USA: CLSI; 2014.  Back to cited text no. 27
    
28.
Chen L, Mediavilla JR, Oliveira DC, Willey BM, de Lencastre H, Kreiswirth BN, et al. Multiplex real-time PCR for rapid staphylococcal cassette chromosome mec typing. J Clin Microbiol 2009;47:3692-706.  Back to cited text no. 28
    
29.
Mehndiratta PL, Bhalla P, Ahmed A, Sharma YD. Molecular typing of methicillin-resistant Staphylococcus aureus strains by PCR-RFLP of SPA gene: A reference laboratory perspective. Indian J Med Microbiol 2009;27:116-22.  Back to cited text no. 29
[PUBMED]  [Full text]  
30.
Grundmann H, Aanensen DM, van den Wijngaard CC, Spratt BG, Harmsen D, Friedrich AW, et al. Geographic distribution of Staphylococcus aureus causing invasive infections in Europe: A molecular-epidemiological analysis. PLoS Med 2010;7:e1000215.  Back to cited text no. 30
    
31.
Tokajian ST, Khalil PA, Jabbour D, Rizk M, Farah MJ, Hashwa FA, et al. Molecular characterization of Staphylococcus aureus in Lebanon. Epidemiol Infect 2010;138:707-12.  Back to cited text no. 31
[PUBMED]    
32.
Baum C, Haslinger-Löffler B, Westh H, Boye K, Peters G, Neumann C, et al. Non-spa-typeable clinical Staphylococcus aureus strains are naturally occurring protein A mutants. J Clin Microbiol 2009;47:3624-9.  Back to cited text no. 32
    
33.
Shakeri F, Ghaemi EA. New Spa types among MRSA and MSSA isolates in North of Iran. Adv Microbiol 2014;4:899-905.  Back to cited text no. 33
    
34.
Bazzoun DA, Harastani HH, Shehabi AA, Tokajian ST. Molecular typing of Staphylococcus aureus collected from a Major Hospital, Amman, Jordan. J Infect Dev Ctries 2014;8:441-7.  Back to cited text no. 34
[PUBMED]    
35.
Harastani HH, Araj GF, Tokajian ST. Molecular characteristics of Staphylococcus aureus isolated from a major hospital in Lebanon. Int J Infect Dis 2014;19:33-8.  Back to cited text no. 35
[PUBMED]    
36.
Khademi F, Ghanbari F, Mellmann A, Najafzadeh MJ, Khaledi A. Phylogenetic relationships among Staphylococcus aureus isolated from clinical samples in Mashhad, Iran. J Infect Public Health 2016;9:639-44.  Back to cited text no. 36
[PUBMED]    
37.
Mohammadi S, Sekawi Z, Monjezi A, Maleki MH, Soroush S, Sadeghifard N, et al. Emergence of SCCmec type III with variable antimicrobial resistance profiles and spa types among methicillin-resistant Staphylococcus aureus isolated from healthcare- and community-acquired infections in the west of Iran. Int J Infect Dis 2014;25:152-8.  Back to cited text no. 37
[PUBMED]    
38.
Strommenger B, Braulke C, Heuck D, Schmidt C, Pasemann B, Nübel U, et al. Spa typing of Staphylococcus aureus as a frontline tool in epidemiological typing. J Clin Microbiol 2008;46:574-81.  Back to cited text no. 38
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04