Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 649 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (449 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~  Results and Disc...
 ~  References
 ~  Article Figures

 Article Access Statistics
    Viewed627    
    Printed22    
    Emailed0    
    PDF Downloaded53    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
BRIEF COMMUNICATION
Year : 2018  |  Volume : 36  |  Issue : 1  |  Page : 113-115
 

Molecular epidemiology of circulating human adenovirus types in acute conjunctivitis cases in Chandigarh, North India


1 Department of Virology, Postgraduate Institute of Medical Education and Research, Chandigarh, India
2 Department of Ophthalmology, Postgraduate Institute of Medical Education and Research, Chandigarh, India

Date of Web Publication2-May-2018

Correspondence Address:
Dr. Mini P Singh
Department of Virology, Postgraduate Institute of Medical Education and Research, Chandigarh - 160 012
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_17_258

Rights and Permissions

 ~ Abstract 

Human adenovirus (HAdV) is a major cause of viral conjunctivitis. The various serotypes implicated in the causation are 3, 4, 8, 19 and 37. The present study aimed to know the circulating types of HAdV causing acute conjunctivitis in North India. A total of 23 conjunctival swabs were collected from patients with clinically suspected acute viral conjunctivitis during 2014–2015. The HAdV was implicated in the etiology in 65.2% of cases. The sequencing of representative samples using hexon gene suggests the presence of serotype 8 and 4. The serotype eight sequences showed 99%–100% similarity with other Indian strains. The phylogenetic analysis showed that the current circulating serotypes, responsible for conjunctivitis, belonged to epidemic keratoconjunctivitis strains.


Keywords: Conjunctivitis, human adenovirus, molecular epidemiology


How to cite this article:
Singh MP, Ram J, Kumar A, Rungta T, Gupta A, Khurana J, Ratho RK. Molecular epidemiology of circulating human adenovirus types in acute conjunctivitis cases in Chandigarh, North India. Indian J Med Microbiol 2018;36:113-5

How to cite this URL:
Singh MP, Ram J, Kumar A, Rungta T, Gupta A, Khurana J, Ratho RK. Molecular epidemiology of circulating human adenovirus types in acute conjunctivitis cases in Chandigarh, North India. Indian J Med Microbiol [serial online] 2018 [cited 2018 Sep 21];36:113-5. Available from: http://www.ijmm.org/text.asp?2018/36/1/113/231663



 ~ Introduction Top


Acute viral conjunctivitis is usually a self-limiting condition characterised by acute follicular conjunctival reaction and preauricular lymphadenopathy.[1] The common etiological agents include adenovirus, herpes simplex virus, varicella-zoster virus, enterovirus 70, coxsackie A24 and human immunodeficiency virus.[2],[3] Human adenovirus (HAdV) is the most common agent involved in viral conjunctivitis accounting for 65%–90% of the cases.[4] HAdVs belong to the genus Mastadenovirus, containing seven species HAdV-A to HAdV-G with 85 genotypes.[5] HAdV Types 3, 4, 8, 37, 54, 56 and 64 are the ones implicated in keratoconjunctivitis.[1],[6] The latter usually occurs in epidemics and is highly contagious and patients present with red-eye, severe chemosis and mucus discharge.[1] The main route of the transmission of the virus is through direct contact with infected secretions and also through fomites.[1]

Worldwide, various outbreaks of keratoconjunctivitis associated with HAdV have been reported of which the Type 8 is mainly responsible.[7] The studies from India have reported the presence of Type 2, 3, 4, 6, 7, 8 and 37.[8],[9],[10],[11],[12] The molecular epidemiology of the circulating strains is important to understand the virus transmission worldwide. The aim of the present study was to identify the circulating types of HAdV in acute conjunctivitis cases in Chandigarh, North India.


 ~ Materials and Methods Top


The conjunctival swabs were collected from 23 sporadic cases with clinically suspected adenoviral conjunctivitis visiting Advanced Eye Center, PGIMER, Chandigarh in 2014–15, after obtaining informed written consent. The study was approved by Institute ethics committee as per national guidelines. The disease was clinically graded as mild, moderate and severe based on the presence of chemosis and mucus discharge by JR and AG.[13]

The samples obtained were transported to the virology laboratory in viral transport medium in the cold chain. The DNA was extracted using the commercially available kit as per the manufacturer's instructions (Qiagen, Germany) and subjected to nested polymerase chain reaction (PCR) targeting hexon gene of HAdV. The amplification was carried out in 25 μl reaction containing 10 mM Tris, 1.5 mM MgCl2, 0.5 μM of each primer [10] and 1U Taq polymerase (Genei, Bangalore). The cycling conditions were: Initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 2 min and final extension at 72°C for 7 min. The amplified products from the 1st round were used for 2nd round amplification by using the same amplification reactions as above. The outer primer sequences were forward = 5'GCCACCTTCTTCCCCATGGC3' and reverse = 5'GTAGCGTTGCCGGCCGAGAA3' and the forward and reverse nested primer sequences were 5' TTCCCCATGGCCCACAACAC 3' and 5' GCCTCGATGACGCCGCGCTG 3', respectively.

The representative samples were processed for type identification. The products of 916 bp were separated by agarose gel electrophoresis, followed by gel elution using Qiagen Gel Extraction Kit (Qiagen, Germany). These products were then sequenced using Sanger method followed by BLAST confirmation. The sequences were then aligned by using ClustalX2.0.11 software (University College Dublin, Dublin, Ireland), and phylogenetic tree was constructed by using Neighbor-Joining algorithm with bootstrap 1000 replicate by using MEGA6.0 software (Center for Evolutionary Medicine and Informatics, Tempe, USA).


 ~ Results and Discussion Top


The mean age of the patients was found to be 43.9 ± 17.7 years with male:female ratio of 3.6:1. The conjunctivitis was unilateral in 12 patients (52.2%) and bilateral in 11 patients (47.8%). The disease was graded as mild, moderate and severe-based on the presence of chemosis in 9 (39.1%), 13 (56.5%) and 1 (4.4%) patient, respectively. A total of 16 (69.6%) and 7 (30.4%) patients reported mild and moderate mucus discharge, respectively.

Out of 23 samples collected, 15 (65.2%) were found to be positive for HAdV by nested PCR. A total of 7 representative samples were subjected to sequencing, out of which 6 were found to be Type 8 and 1 of Type 4. The sequences were submitted to Genbank vide accession numbers KX431315–18, KX4313120–22. The BLAST analysis showed a sequence identity of 99%–100% for Type 8 with sequences from Hyderabad, New York, Tunisia. For Type 4, 100% identity was observed with Tunisian and Chinese sequences. In the phylogenetic analysis, Type 8 and Type 4 clustered with similar types under Group D and E, respectively [Figure 1].
Figure 1: Phylogenetic analysis of Postgraduate Institute of Medical Education and Research isolates along with various other types of human adenovirus

Click here to view


In the present study, positivity of 65% was observed for HAdV among patients with acute conjunctivitis. The previous studies from India have shown the positivity of 13.8%–66.6% for HAdV among the patients with keratoconjunctivitis.[8],[9],[10],[12] Among the various species of HAdV (A-G), B, D and E are more commonly involved in conjunctivitis.[1] In the present study, the authors identified the presence of HAdV Types 8 and 4 belonging to the Group D and E, respectively, by using primers targeting the hexon region. Worldwide, the Genotype 8 is more prevalent (involved in up to 44%–100% of epidemic keratoconjunctivitis outbreaks), whereas Type 4 is implicated in 7%–11% of outbreaks.[7] In the present study, Type 8 was involved in 6/7 (85.7%) and Type 4 in 1/7 (14.3%) of represented samples. The studies from India have previously reported the presence of Type 8 from Pune and Puducherry in 78.6% and 100% of cases, respectively, and Type 4 from Chennai and Pune (7.2%).[2],[12]

In the present study, the phylogenetics relatedness was not possible with sequences from Pune as latter was sequenced using penton and fibre gene. However, sequence identity of 99%–100% was observed for Type 8 to that of other Indian strains from Hyderabad (KR303745, KR303748–50) and Puducherry (KR150657–667). The present study suggests the predominance of Type 8 strains and their similar circulating patterns in India.

It is important to carry out the sequencing and phylogenetics analysis to identify any variation in circulating types. Only a few countries, such as the US and Japan, are doing appropriate surveillance of HAdV.[14] Limited literature is available from North India concerning the molecular identification and genotyping of HAdV. The present study adds up to the knowledge of existing circulating strains of HAdV from North India. Further molecular studies will help to the identification and origin of outbreaks and development of control programmes.

Acknowledgement

The study was funded by Department of Science and Technology (U. T.), Chandigarh vide the sanction number SandT/SANC/09/2013/1091–1096 Dated 9/9/13.

As mentioned in acknowledgment.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 ~ References Top

1.
Ghebremedhin B. Human adenovirus: Viral pathogen with increasing importance. Eur J Microbiol Immunol 2014;4:26-33.  Back to cited text no. 1
    
2.
Gopalkrishna V, Patil PR, Kolhapure RM, Bilaiya H, Fulmali PV, Deolankar RP, et al. Outbreak of acute hemorrhagic conjunctivitis in Maharashtra and Gujarat states of India, caused by coxsackie virus A-24 variant. J Med Virol 2007;79:748-53.  Back to cited text no. 2
    
3.
American Academy of Ophthalmology. Cornea/External Disease Panel. Preferred Practice Pattern ® Guidelines. Conjunctivitis. San Francisco, CA: American Academy of Ophthalmology; 2013. Available from: http://www.aao.org/ppp. [Last accessed on 2016 Nov 30].  Back to cited text no. 3
    
4.
O'Brien TP, Jeng BH, McDonald M, Raizman MB. Acute conjunctivitis: Truth and misconceptions. Curr Med Res Opin 2009;25:1953-61.  Back to cited text no. 4
    
5.
HAdV Human Adenovirus Working Group, November 2017 Update. Available from: http://www.hadvwg.gmu.edu/. [Last accessed on 2017 Dec 29].  Back to cited text no. 5
    
6.
Zhou X, Robinson CM, Rajaiya J, Dehghan S, Seto D, Jones MS, et al. Analysis of human adenovirus type 19 associated with epidemic keratoconjunctivitis and its reclassification as adenovirus type 64. Invest Ophthalmol Vis Sci 2012;53:2804-11.  Back to cited text no. 6
[PUBMED]    
7.
Zhang L, Zhao N, Sha J, Wang C, Jin X, Amer S, et al. Virology and epidemiology analyses of global adenovirus-associated conjunctivitis outbreaks, 1953-2013. Epidemiol Infect 2016;144:1661-72.  Back to cited text no. 7
[PUBMED]    
8.
Dalapathy S, Lily TK, Roy S, Madhavan HN. Development and use of nested polymerase chain reaction (PCR) for the detection of adenovirus from conjunctivitis specimens. J Clin Virol 1998;11:77-84.  Back to cited text no. 8
[PUBMED]    
9.
Gopalkrishna V, Ganorkar NN, Patil PR. Identification and molecular characterization of adenovirus types (HAdV-8, HAdV-37, HAdV-4, HAdV-3) in an epidemic of keratoconjunctivitis occurred in Pune, Maharashtra, Western India. J Med Virol 2016;88:2100-5.  Back to cited text no. 9
[PUBMED]    
10.
Janani MK, Malathi J, Madhavan HN. Isolation of a variant human adenovirus identified based on phylogenetic analysis during an outbreak of acute keratoconjunctivitis in Chennai. Indian J Med Res 2012;136:260-4.  Back to cited text no. 10
[PUBMED]  [Full text]  
11.
Janani MK, Vimalin Jeyalatha M, Padmanaban P, Madhavan HN, Malathi J. Outbreak of epidemic keratoconjunctivitis caused by human adenovirus type 2 in Chennai, India in 2014. Austin J Clin Ophthalmol 2015;4:1054.  Back to cited text no. 11
    
12.
Madhavan HN. Laboratory investigations on viral and chlamydia trachomatis infections of the eye: Sankara Nethralaya experiences. Indian J Ophthalmol 1999;47:241-6.  Back to cited text no. 12
[PUBMED]  [Full text]  
13.
Lyra AF, Bastos LC, Lima RC, Maranhão Lde V, Arantes TE. Artificial tears alone versus 0.45% ketorolac tromethamine with artificial tears for the treatment of acute viral conjunctivitis. Arq Bras Oftalmol 2014;77:99-102.  Back to cited text no. 13
    
14.
Aoki K, Tagawa Y. A twenty-one year surveillance of adenoviral conjunctivitis in Sapporo, Japan. Int Ophthalmol Clin 2002;42:49-54.  Back to cited text no. 14
[PUBMED]    


    Figures

  [Figure 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04