Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 716 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (376 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed290    
    Printed5    
    Emailed0    
    PDF Downloaded58    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
BRIEF COMMUNICATION
Year : 2017  |  Volume : 35  |  Issue : 3  |  Page : 417-420
 

Investigation of an outbreak of varicella in Chandigarh, North India, using a real-time polymerase chain reaction approach


1 Department of Virology, Postgraduate Institute of Medical Education and Research, Chandigarh, India
2 School of Public Health, Postgraduate Institute of Medical Education and Research, Chandigarh, India

Date of Web Publication12-Oct-2017

Correspondence Address:
Mini P Singh
Department of Virology, Postgraduate Institute of Medical Education and Research, Chandigarh - 160 012
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_16_420

Rights and Permissions

 ~ Abstract 

Outbreaks of varicella are reported when susceptible population accumulates. This study reports a chickenpox outbreak in Burail in August 2014, wherein 20 laboratory-confirmed cases were identified by the detection of varicella zoster virus (VZV) DNA and VZV IgM antibodies. The viral load between vesicular swabs and serum samples from 8 patients with active lesions was found to have good correlation and further also related with disease severity. Real-time polymerase chain reaction can be useful for early diagnosis of an outbreak and vesicular swab can be used as a less invasive sample for assessing the disease severity.


Keywords: Outbreak, real-time polymerase chain reaction, varicella, vesicular swabs


How to cite this article:
Singh MP, Kaur R, Kumar A, Gupta M, Garg S, Ratho R K. Investigation of an outbreak of varicella in Chandigarh, North India, using a real-time polymerase chain reaction approach. Indian J Med Microbiol 2017;35:417-20

How to cite this URL:
Singh MP, Kaur R, Kumar A, Gupta M, Garg S, Ratho R K. Investigation of an outbreak of varicella in Chandigarh, North India, using a real-time polymerase chain reaction approach. Indian J Med Microbiol [serial online] 2017 [cited 2018 Apr 26];35:417-20. Available from: http://www.ijmm.org/text.asp?2017/35/3/417/216620



 ~ Introduction Top


Varicella is a highly contagious disease caused by varicella zoster virus (VZV) belonging to the family Herpesviridae. The transmission of the disease is direct through skin lesion or airborne spread.[1] The primary infection is self-limiting and results in acute varicella which usually presents as fever, malaise and a widely disseminated vesicular and pruritic rash predominantly involving the trunk and face.[2] The disease has an incubation period of 10–21 days,[3] with a high secondary attack rate of >85% among susceptible contacts.[4]

Before the varicella vaccine was licensed, approximately 4 million cases, 10,500 hospitalisations and 105 deaths due to varicella were reported each year.[5] The introduction of a live attenuated VZV vaccine led to substantial decline in morbidity and mortality due to varicella in the United States.[6] Despite the high vaccination coverage, outbreaks still continued to occur in schoolgoing children between 2001 and 2005, resulting in the introduction of a two-dose vaccination schedule in 2006,[3] which lead to a drastic decline in the number of cases. However, VZV vaccine is still not included in the Universal Immunisation Programme of India, and hence, sporadic outbreaks are still reported.[7],[8] The present study reports an outbreak in Burail area near Chandigarh, India.


 ~ Materials and Methods Top


After receiving information regarding cases of maculopapulovesicular rash with or without fever in August 2014, active surveillance of the area was initiated. Samples were collected after written informed consent in case of adults/parents in case of children. This study was approved by the Institute Ethics Committee. In all, 28 clinical cases were identified and blood samples obtained from 26 cases and 27 age-matched and sex-matched controls. The serum samples obtained were then tested qualitatively for the presence of anti-VZV IgM and IgG antibodies using commercial kit (Demeditec Diagnostics, GmbH, Germany). Vesicular swabs were obtained from 8 cases showing active lesions. The disease severity was assessed as described earlier.[9] The score index for mild was ≤7, moderately severe was 8–15 and for severe disease was ≥16.

Both the vesicular swabs and serum samples of active cases were subjected to DNA isolation using commercial kit (Qiagen, Germany) followed by real-time polymerase chain reaction (PCR) using 1X TaqMan Universal master mix II (Applied Biosystems, USA), 500 nM of each primer (Forward = 5'CCATCCGATTATGC CACCTTTACAG3'; Reverse = 5'TCGAACGTTA GAGCGCACAA3) and 250 nM of NED labelled probe (5'TTGGAGGAAAACGTCTTTTTT3') targeting ORF 28 (DNA polymerase) and run on ABI 7500 real-time instrument.(Applied Biosystems, USA).

The Spearman's correlation coefficient (rs) and Mann–Whitney U-tests were performed. The P < 0.05 was considered statistically significant The SPSS version 22.0 (IBM, USA) was used for the statistical calculation.


 ~ Results Top


In the present outbreak, 28 suspected cases of chickenpox were identified with median age of 8 years (1.5–38 years) and male-to-female ratio of 0.55:1. The cases occurred from the 3rd week of May and lasted till the 2nd week of August 2014. The children with age <15 years were mainly affected (64.3%). Two pregnant women were also infected, with a gestation period of 32 weeks and 28 weeks, respectively. The cases mainly presented with maculopapulovesicular lesions (96.43%) and fever (82.14%). None of the patients had received acyclovir treatment.

Out of 26 blood samples collected, 18 (69.23%) were found to have VZV IgM antibodies. Similarly, 18 (69.23%) patients were positive for VZV IgG antibodies. Both VZV IgM and IgG antibodies were detected in 14/26 (53.87%) patients. One out of 27 healthy controls was positive for VZV IgM antibodies, whereas 13/27 (48.15%) had IgG antibodies to varicella.

The VZV DNA could be demonstrated by real-time PCR in all the 8 vesicular swabs and 8 serum samples with mean viral load of 61,500 copies/μl (93.3–4.9 × 105 copies/μl) and 40,000 copies/μl (17.9–1.7 × 106 copies/μl), respectively [Table 1]. A statistically significant positive correlation was found between viral load of vesicular swabs and serum samples rs= 0.88; P = 0.004. Out of 8 patients with active disease, 2 had mild infection and 6 had moderate/severe illness. A significant difference was found in viral load (serum and vesicular swabs) of patients with moderate/severe illness (median = 90500 copies/μl and 1, 95,500 copies/μl) compared to patients with mild presentation (median = 30 copies/μl and 354 copies/μl) (P = 0.046) [Figure 1].
Table 1: Serological and molecular profile of active varicella cases

Click here to view
Figure 1: Correlation of viral load with clinical disease severity in patients with active lesions. (a) Vesicular swabs and (b) serum

Click here to view



 ~ Discussion Top


This study reports the investigation of an outbreak of varicella in Burail which is inhabited by population from neighbouring states of Chandigarh who have low socioeconomic status and is overcrowded. As observed earlier,[7],[8] children <15 years of age were predominantly affected. Out of 28 cases, 20 were laboratory confirmed (18 confirmed by IgM testing and 2 additional samples positive by real-time PCR). Among 26 blood samples tested, 8 were found to be negative for anti-VZV IgM antibodies. Out of these 8 patients, 4 gave a history of previous varicella exposure and were positive for VZV IgG antibodies. Four patients did not have both anti-VZV IgM and IgG antibodies and gave a history of rash duration <5 days by which time the IgM antibody response may not have developed.

The detection and quantification of viremia during varicella infection may be potentially useful for diagnostic, prognostic and therapeutic monitoring purposes.[10] In our study, real-time PCR could detect viremia in patients presenting as early as 3 days of illness. An early diagnosis in an outbreak situation is desirable for prompt initiation of control measures, to prevent the further spread of outbreak, especially to pregnant women and immunocompromised individuals.

Varicella diagnosis and management in pregnancy demands little more attention based on the mortality rates.[11] Two pregnant women gave history of exposure to varicella cases, out of which one was detected to have fetal anencephaly during her level-II ultrasound at 18–20 weeks of gestation; however, she did not terminate her pregnancy and later acquired VZV infection. This patient had a high viral load in both serum and vesicular swab samples. She did not take any acyclovir treatment, and on follow-up, she had intrauterine fetal death. In contrast, the other pregnant lady who presented in convalescent phase received acyclovir treatment and delivered a healthy term baby.

The quantitative viral load detection has also been found useful in monitoring the treatment response of patients receiving antiviral therapy against VZV.[12]

A limitation of our study was that the sample size of active cases was small to definitely comment on the correlation of viral load with disease severity. A positive correlation between viral load of vesicular swabs and serum samples suggests that vesicular swab samples can be used as an alternative to serum samples for viral load determination which is a less invasive procedure.

Majority (69.2%) of the cases identified in our study were primary cases of varicella as shown by the presence of VZM IgM antibodies. However, 4 patients had only anti-VZM IgG antibodies and were negative for anti-VZM IgM antibodies possibly suggesting reinfection. A limitation of our study was that the patients were not followed up as the basic aim of this study was to assess the role of real-time PCR in early diagnosis of varicella.

The introduction of varicella vaccine in the United States (1995) has drastically reduced the number of varicella cases, and thereby decreasing hospital admissions (88%) and childhood mortality (74%–92%) (2002).[13] VZV vaccine can also be useful in outbreak settings if given within 3–5 days of exposure.[14] This vaccine is found to have a good safety profile and high effectiveness, especially in immunocompetent individuals. The available evidence also support the use of two-dose vaccine over single dose as the second dose of varicella vaccine appears to be highly effective (93%) in preventing disease of any severity. Furthermore, the individuals receiving two doses of vaccine develop breakthrough disease less often, and when breakthrough disease does occur it is generally milder when compared to that unvaccinated individuals.[3],[15]

This vaccine is presently recommended by the Indian Academy of Paediatrics to be given as two doses.[16] However, it is still not a part of Universal Immunisation Programme of our country. This contributes to one of the major reasons for the repeated occurrence of outbreaks. Various concerns which have decreased the worldwide acceptance of this vaccine are fear of increase of Herpes zoster incidence, the fear of age shift of the disease towards older age groups, and the economic burden of universal vaccination implementation.[17] The vaccine is currently available in India as Okavax (Aventis Pasteur) and Varilrix (GlaxoSmithKline) with approximate price of 1200–1500 INR.

The authors recommend that this vaccine should be included in the national immunisation schedule to control these outbreaks and a sustained use can also pave the way to a world without varicella.

Financial support and sponsorship

This research did not receive any specific grant from funding agencies in public, commercial or not-for-profit sectors. The work was carried out as a part of routine investigation of an outbreak of VZV.

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Pergam SA, Limaye AP, AST Infectious Diseases Community of Practice. Varicella zoster virus (VZV) in solid organ transplant recipients. Am J Transplant 2009;9 Suppl 4:S108-15.  Back to cited text no. 1
    
2.
Heininger U, Seward JF. Varicella. Lancet 2006;368:1365-76.  Back to cited text no. 2
    
3.
Papaloukas O, Giannouli G, Papaevangelou V. Successes and challenges in varicella vaccine. Ther Adv Vaccines 2014;2:39-55.  Back to cited text no. 3
    
4.
Sartori AM. A review of the varicella vaccine in immunocompromised individuals. Int J Infect Dis 2004;8:259-70.  Back to cited text no. 4
    
5.
Nguyen HQ, Jumaan AO, Seward JF. Decline in mortality due to varicella after implementation of varicella vaccination in the United States. N Engl J Med. 2005;352:450-8.  Back to cited text no. 5
    
6.
Hambleton S, Gershon AA. Preventing varicella-zoster disease. Clin Microbiol Rev 2005;18:70-80.  Back to cited text no. 6
    
7.
Singh MP, Chandran C, Sarwa A, Kumar A, Gupta M, Raj A, et al. Outbreak of chickenpox in a Union Territory of North India. Indian J Med Microbiol 2015;33:524-7.  Back to cited text no. 7
[PUBMED]  [Full text]  
8.
Singh MP, Singh G, Kumar A, Singh A, Ratho RK. Epidemiologic lessons: Chickenpox outbreak investigation in a rural community around Chandigarh, North India. Indian J Pathol Microbiol 2011;54:772-4.  Back to cited text no. 8
[PUBMED]  [Full text]  
9.
Vázquez M, LaRussa PS, Gershon AA, Niccolai LM, Muehlenbein CE, Steinberg SP, et al. Effectiveness over time of varicella vaccine. JAMA 2004;291:851-5.  Back to cited text no. 9
    
10.
Hawrami K, Breuer J. Development of a fluorogenic polymerase chain reaction assay (TaqMan) for the detection and quantitation of varicella zoster virus. J Virol Methods 1999;79:33-40.  Back to cited text no. 10
    
11.
Paryani SG, Arvin AM. Intrauterine infection with varicella-zoster virus after maternal varicella. N Engl J Med 1986;314:1542-6.  Back to cited text no. 11
    
12.
Ishizaki Y, Tezuka J, Ohga S, Nomura A, Suga N, Kuromaru R, et al. Quantification of circulating varicella zoster virus-DNA for the early diagnosis of visceral varicella. J Infect 2003;47:133-8.  Back to cited text no. 12
    
13.
WHO, UNICEF, World Bank. State of the World's Vaccines and Immunization. 3rd ed. Geneva: World Health Organization; 2009. Available from: http://www.apps.who.int/iris/bitstream/10665/44169/1/9789241563864_eng.pdf. [Last accessed on 2016 Dec 05].  Back to cited text no. 13
    
14.
Asano Y, Nakayama H, Yazaki T, Kato R, Hirose S. Protection against varicella in family contacts by immediate inoculation with live varicella vaccine. Pediatrics 1977;59:3-7.  Back to cited text no. 14
    
15.
Marin M, Marti M, Kambhampati A, Jeram SM, Seward JF. Global varicella vaccine effectiveness: A Meta-analysis. Pediatrics 2016;137:e20153741.  Back to cited text no. 15
    
16.
Vashishtha VM, Choudhury P, Kalra A, Bose A, Thacker N, Yewale VN, et al. Indian academy of pediatrics (IAP) recommended immunization schedule for children aged 0 through 18 years – India, 2014 and updates on immunization. Indian Pediatr 2014;51:785-800.  Back to cited text no. 16
    
17.
Bonanni P, Breuer J, Gershon A, Gershon M, Hryniewicz W, Papaevangelou V, et al. Varicella vaccination in Europe – Taking the practical approach. BMC Med 2009;7:26.  Back to cited text no. 17
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04