Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 2038 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (570 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed801    
    Printed59    
    Emailed0    
    PDF Downloaded108    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 35  |  Issue : 3  |  Page : 381-388
 

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species


1 Department of Microbiology, Tata Medical Center, Kolkata, West Bengal, India
2 Department of Clinical Hematology, Tata Medical Center, Kolkata, West Bengal, India
3 Department of Microbiology, WHO Collaborating Center for Reference and Research of Fungi of Medical Importance, PGIMER, Chandigarh, India

Date of Web Publication12-Oct-2017

Correspondence Address:
S Bhattacharya
Department of Microbiology, Tata Medical Center, 14 Major Arterial Road (EW), New Town, Rajarhat, Kolkata - 700 156, West Bengal
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_17_190

Rights and Permissions

 ~ Abstract 

Purpose: Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Materials and Methods: Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Results: Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. Conclusion: The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.


Keywords: 28S rDNA, Aspergillus species, beta-tubulin gene, calmodulin gene, DNA extraction, real-time polymerase chain reaction


How to cite this article:
Das P, Pandey P, Harishankar A, Chandy M, Bhattacharya S, Chakrabarti A. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species. Indian J Med Microbiol 2017;35:381-8

How to cite this URL:
Das P, Pandey P, Harishankar A, Chandy M, Bhattacharya S, Chakrabarti A. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species. Indian J Med Microbiol [serial online] 2017 [cited 2018 Oct 22];35:381-8. Available from: http://www.ijmm.org/text.asp?2017/35/3/381/216624



 ~ Introduction Top


Invasive aspergillosis (IA) represents a serious health problem for the immunocompromised patients, especially those undergoing cancer chemotherapy, or receiving corticosteroid therapy or immunosuppressive drugs for treatment.[1],[2] Western and temperate country based reports suggest prevalence of Aspergillus fumigatus is more common than any other Aspergillus sp. However, other species, including Aspergillus flavus, Aspergillus terreus, Aspergillus niger, Aspergillus nidulans and Aspergillus ustus can also cause human infection, whereas in India, A. flavus is the most common etiological agent of IA.[3],[4]

Conventional diagnostic approaches, such as histopathology and culture, still remain the gold standard but have poor sensitivity and have a long turn-around time. Serologic techniques, such as galactomannan (GM) and beta-D-glucan, have already been incorporated into clinical guidelines, but recent evidence showed that their performance is influenced by the cutoff value.[5],[6],[7] Cultures of respiratory specimens have relatively low positive predictive value (about 72% in one study) which can decrease even more when testing non-hematology patients or patients who are already receiving antifungal agents.[8],[9] Molecular methods, such as the Aspergillus sp. specific polymerase chain reaction (PCR), have not yet found their place in clinical practice guidelines mainly due to the lack of standardization. However, currently, no nucleic acid-based tests have been externally validated for IA detection and hence, PCR is not included in the current European Organization for Research and Treatment of Cancer-Mycology Study Group diagnostic criteria.[10],[11]

Development of Aspergillus PCR is promising diagnostic tool but faces barriers to its implementation in clinical practice.[12] Other molecular identification methods for identification of Aspergillus sp. is mainly sequence based.[13] However, all these techniques are either time-consuming or labor demanding and are thus impractical in most clinical laboratories. On the other hand, the ultimate sensitivity of any PCR assay for the detection of fungal pathogens depends on the efficient lysis of fungal cells in the sample and the purification of DNA that is free of PCR inhibitors.[14] DNA extraction is also a very important step, especially for filamentous fungi.[15],[16] Exact diagnosis of IA remains complicated due to non-specificity of clinical signs and the difficulty in obtaining proper specimens for diagnosis. As a result significant proportion of cases remains undetected.[17] The recently developed standardised methodologies by the European Aspergillus PCR Initiative for Aspergillus DNA extraction from whole blood specimens requires multi-centric evaluation. There are only very few studies from India regarding IA using molecular based methods.[18] In this study, we evaluated three different methodologies, for extraction of pure and high yield DNA from a wide range of medically important filamentous fungal species and finally developed a two-step real-time PCR targeting 28S rDNA, beta-tubulin and calmodulin gene for early detection of four medically important Aspergillus sp. commonly found in our cancer hospital and bone marrow transplantation center.


 ~ Materials and Methods Top


Test isolates

Four medically important Aspergillus sp., i.e., three reference isolates A. fumigatus (ATCC-1022), A. niger (ATCC-16404), A. flavus (ATCC-204304) and one clinical isolate A. terreus (verified by DNA sequencing) were used for standardization of all the experiment. The isolates were maintained as a suspension in sterile distilled water at room temperature through periodic viability checking. All fungal species were grown on Sabourauds Dextrose Agar (BD Difco, USA) incubated for at least 5 days at two different temperature, i.e., 37°C and 25°C. After incubation, fungal spores were suspended in normal saline. The inoculum size was initially adjusted to an optical density adjusted to OD 0.6 nm by spectrophotometer (wavelength, 530 nm), (Bio-Rad Lab, Smart Spec Plus, and USA) and finally, it was adjusted to 1.0 × 108 conidia/ml by microscopic enumeration with a cell-counting hematocytometer. Serial dilutions of this suspension were made in sterile normal saline. All other tested microbial isolates [Table 1] were used for quality checks.
Table 1: Specificity test of Aspergillus polymerase chain reaction

Click here to view


Precautions taken to avoid cross contamination

Dedicated pipettes, aerosol barrier filter tips and molecular grade reagents were used for extraction and PCR amplification. A unidirectional work flow was followed. The extraction of DNA, preparation of master-mix, addition of template and amplification were carried out in Class II, Type A2 Biological Safety Cabinet hoods (Thermo Scientific, USA) with ducted facility in separate laboratories that were independently equipped. All work surfaces were wiped with 150 ppm sodium hypochlorite and 70% ethanol at every stage.

Collection of isolates other than Aspergillus species

A collection of 34 DNA extracts include bacteria, fungus (yeast and mold), virus and human male and female DNA was used for this study [Table 2]. All clinical isolates other than standard reference isolates used in this study were obtained and confirmed in the microbiology laboratory of Tata Medical Center, Kolkata, India. All bacterial and yeast clinical strains used in this study were confirmed by automated Vitek 2 (bioMérieux, France). Viruses, like Cytomegalovirus WHO 1st international standard for CMV NIBSC 09/162 were used in this study. Other viral isolates herpes simplex virus (HSV 1 and HSV 2) was gifted by clinical virology laboratory of Christian Medical College, Vellore, India.
Table 2: Probes and primers used for Aspergillus polymerase chain reaction

Click here to view


Extraction of fungal DNA

Protocol A

Using QIAamp DNA mini kit, (Qiagen, USA) with prior chemical treatment: in this protocol, we introduced a chemical treatment like sodium dodecyl sulfate or SDS (Sigma-Aldrich) or β-mercaptoethanol, (Sigma-Aldrich, USA) before commercial kit extraction step.

Protocol B

QIAamp DNA mini kit with glass beads (BioSpec, USA): extraction was performed using a modification of protocol A, where the chemical treatment step was replaced with boiling for 10 min followed by freezing the sample at −50°C and agitation with 0.5 mm glass beads. Qiagen buffer ATL was added to each tube and a volume of sterile glass beads approximately equal to 100 μl was added. Samples were processed for 30 s pulse at 5000 rpm in a Mini-BeadBeater-8 (BioSpec Products), followed by centrifugation at 13,200 rpm in a centrifuge (Eppendorf) for 10 min. After re-suspending the cell pellet in Qiagen buffer AL with proteinase K and incubating at 55°C for 10 min, the supernatant fluid from each tube was transferred to sterile 1.5 ml microcentrifuge tubes and extraction was continued using a QIAamp DNA mini kit according to the manufacturer's instructions. The nucleic acid was eluted in 50 μl Qiagen buffer AE.

Protocol C

This protocol used completely automated QIAcube extraction using QIAamp DNA mini kit (Qiagen, Valencia, CA): For this protocol, initial concentration of the sample was fixed 0.5–1.0 MacFarland standard. Extraction was carried out according to the manufacturer's guideline and the eluted in 50 μl Qiagen buffer AE.

The DNA recovered in all procedures was immediately analysed or stored at −20°C until further use. All tested protocols were repeated at least three times for reproducibility of yield and quality. Integrity of the genomic DNA was checked by three different methods. First, NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) in triplicate to determine the DNA concentration and the absorbance at 260 nm (A260), of the samples from each extraction protocol. In addition, the absorbance at 280 nm (A280) was measured and the A260/A280 ratio determined for the purity of DNA. A mean was taken for all the samples extracted from each protocol to determine the average A260 value and A260/A280 ratio. Second, for each isolates 4 μl of extracted DNA stock solutions were dissolved in AE buffer (Qiagen, USA) were visually checked under ultraviolet-light after electrophoresis on 0.8% agarose gels, using Lambda DNA/HindIII Marker (Thermo Scientific, USA) as a reference marker. Finally, the yield and purity of extracted DNA for three different DNA extraction protocols was compared by a Aspergillus sp. specific real-time PCR assay targeting rRNA gene.

Polymerase chain reaction primer design

In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second species-specific PCR, the targets were beta-tubulin (for A. fumigates, A. flavus, A. terreus), gene and calmodulin gene (for A. niger). The 28S rDNA gene sequences of fungi, humans, mice, rats, mite, algae, pollens and bacteria were retrieved from the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/Entrez). The pan-Aspergillus fungal primers and probe, along with beta-tubulin and calmodulin primers/probes were designed using the array of 28S rDNA/beta-tubulin/calmodulin gene sequences by 'Primer 3 V.0.4' software (http://bioinfo.ut.ee/primer].4.0/) (Untergasser et al. 2007). The primers and probe were homologous for the fungi, but not homologous with other organisms (i.e., humans, rats, mice, mite, algae, bacteria and pollens). Note that, although bacteria and algae were examined in their sequences during the primer design, they were not included in the actual experimental tests, because their sequences contain >10 mismatched bases with the designed primers and were thought not to be conducive to cross-amplification. The specificity of our fungal primers was examined by comparing with published 'universal' fungi primers. All the primers used in this study were synthesised by Sigma Aldrich Chemicals Pvt. Ltd., India.

Pan-Aspergillus polymerase chain reaction amplification

The TaqMan based real-time PCR assay was carried out with the custom designed 28S rDNA region specific primers and probes (Sigma-Aldrich, USA). Specificity of the primers and probes were checked using NCBI blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast). The following sequences of the forward primer 5'-TCTAAATGGGTGGTAAATTTC'3, reverse primer 5'-CATCTTTCGATCACTCTACT'3 and the probe were 6[FAM] GCTAAATACTGGCCGGAGACC[BHQ1] were used for the PCR assay. Each reaction contained 12.5 ul Quantitect multiplex PCR master mix (Qiagen, MA, USA), 250 mM of each primer (forward and reverse) with 150 nM of probe (Reporter FAM, Quencher TAMRA) and 5 μl of DNA template were used. PCR reaction were run on the Rotor Gene Q (Qiagen, Germany) thermocyclers with a total reaction volume of 25 μl with 40 cycles with a initial hold at 95°C for 10 min followed by cycling including 95°C for 30 s, annealing at 55°C for 60 s and finally analysis through the green channel.

Species specific polymerase chain reaction

This PCR involved detection of the beta-tubulin or calmodulin gene targets, and was only done if the first step PCR was positive. It was found that the beta-tubulin gene of A. niger was closely related to Penicillum species. Hence, a different gene target (namely calmodulin) was selected for A. niger detection. No such problem of cross reactivity was noted for A. fumigatus, A. flavus and A. terreus.

Each PCR reaction contained 12.5 ul Quantitect multiplex PCR master mix (Qiagen, MA, USA), 250 mM of each primer (forward and reverse) with 150 nM of the probe (Reporter FAM, Quencher TAMRA) [Table 1] and 5 μl of DNA template were used. PCR reaction were run on the Rotor Gene Q (Qiagen, Germany) thermocyclers with a total reaction volume of 25 μl with 40 cycles with a initial hold at 95°C for 10 min followed by cycling consisting of 95°C for 30 s, annealing at 58°C for 60 s, and finally analysis through the green channel.

Spiked specimens

To assess the limit of detection of the assay, we selectively prepared inoculum of all four tested Aspergillus sp containing 108 conidia/ml by using a cell-counting hematocytometer. 3 ml of the primary specimen (whole blood) was spiked with this suspension by serial dilutions (using 1:10 dilution of the original stock in distilled water) were prepared to yield eight different 1-ml inocula ranging from 108 conidia/ml to 102 conidium/ml. Each dilution was used for DNA extraction followed by real-time PCR. All isolates were tested in triplicate.

The DNA extracted was quantified using an in-house real-time PCR to establish equivalence between conidia/ml and ng of DNA/ml.

Melting curve experiment

Melt curve analyses were performed in the Rotorgene Q real-time PCR instrument. The PCR was performed on 5 μL of nucleic acid extracted by our in-house standardised protocol B. The DNA concentrations used in the PCR ranged from 4.6 to 10.4 ng/reaction. The total PCR volume was 20 μL and contained SYBR Green qPCR ReadyMix (2X) (Sigma, USA),0.2 μM each of the forward and reverse Aspergillus primers and 5 μl water. Temperature cycling was performed with initial holds at 58°C for 5 min and 95°C for 1 min, followed by 42 cycles of amplification, then run through the post-PCR melting step (38°C to 95°C ramp at a rate of 0.05°C/s), with continuous signal acquisition.

DNA sequencing and sequencing data analysis

ß-tubulin and calmodulin (βtub and CaM genes) partial sequences available in NCBI and EMBL for Aspergillus species of section Fumigati were aligned and compared employing the Geneious software version 4.7 (Biomatters Ltd, Auckland, New Zealand) and BioEdit sequence alignment editor (available at http://www.ctu.edu.vn/~dvxe/Bioinformatic/Software/BioEdit.htmwebsite). Sequencing results from this study, which included sequences from several A. fumigatus isolates and from ten strains of section Fumigati, were added to a final database that included all partial sequences of βtub and CaM genes. Based on comparisons of all of the aligned sequences, polymorphic sites that were able to discriminate different fungal species were identified.

Statistical analysis

Data are expressed as mean ± standard deviations of at least three independent experiments. Results from all studies were compared with unpaired two-tailed Student's t-test and P < 0.05 was considered to be statistically significant.

Nucleotide sequence accession number

DNA sequencing results for isolates used for probe design were deposited with GenBank, and the accession numbers are as follows: A. flavus strain CDC B-5333, AF117920; A. fumigatus strain CDC B-1172, U93683; A. nidulans strain CDC B-5446, U93686; A. niger strain CDC B-5331, U93685; A. terreus strain CDC B-5502, U93684; A. ustus strain ATCC 16801, AF454136; and A. versicolor strain ATCC 10072, AF454142.

All necessary permits were obtained for the study. The study was approved by the Institutional Review Board, Tata Medical Center, Kolkata, India.


 ~ Results Top


Optimization of DNA extraction from Aspergillus species

All samples extracted by each extraction process were run in triplicate, and the median value was recorded, giving three different figures per extraction. The median of these three values was then taken to give an overall figure for comparison [Figure 1].
Figure 1: Comparative yield of nucleic acid followed by three different extraction protocol used in this study

Click here to view


Within each protocol, major differences in yield and purity were observed between the three individual tested protocols from the same amount of initial inoculum concentrations used (1.0 × 108 conidia/ml). Protocol B achieved the best result as compared to other two protocols. The result of protocol A for all four tested Aspergillus sp. had DNA concentration in the range from 96.2 to 158 ± 25.83 ng/μl (tested in triplicate), and the purity was 1.9–1.7 ± 0.07. Protocol A had 30 ng/μl of DNA, and their purity was 0.89–1.2 ± 013. The yield of DNA using Protocol B found to be significantly higher (P < 0.05) for four Aspergillus sp. [Figure 1].

The automated methods (using QIACube, Qiagen, Germany) gave a lower yield of DNA over a range of concentrations than the other two protocols; with the Ct values obtained consistently being three to four cycles higher than the equivalent sample that was extracted manually (data not shown).

In vitro performance testing for specificity of the primers

To analyze the accuracy and purity of the extracted DNA by our custom designed primers and probes, we used real-time PCR. The threshold was set manually to be above all of the negative controls. Therefore, all samples that were above the threshold were deemed positive, and the Ct value was recorded.

The Aspergillus PCR assays were tested for specificity by utilizing a panel of 34 species [Table 2]. The Aspergillus species- and genus-specific primers were designed to maximize homology to the target species and minimize homology to the nontarget species, respectively. The species-specific assays detected only the target species, as summarised in [Table 1]. The pan-Aspergillus real-time PCR assay detected all Aspergillus sp. tested [Table 3]. To assess the potential for cross-reactivity with other molds, the pan-Aspergillus, A. fumigatus, A. flavus and A. terreus assay oligonucleotides were analysed using BLAST searches against other major hyaline and pigmented mold pathogens and were determined to be not cross-reactive with the following genera: Fusarium, Scedosporium, Paecilomyces, Alternaria, Cladosporium. Rare matches were encountered in Paecilomyces BLAST searches using the pan-Aspergillus assay oligonucleotides as query sequences. Paecilomyces marquandii, Paecilomyces variotii and several Byssochlamys sp. (teleomorph of Paecilomyces) sequences matched the pan-Aspergillus assay sequences, but the matches were infrequent. Most of the available sequences of the suspect Paecilomyces spp. did not match the pan-Aspergillus assay sequences.
Table 3: Confirmation regarding cross reactivity of Aspergillus primers and probe

Click here to view


Analytical specificity and sensitivity of custom designed oligonucleotide for species specific Aspergillus polymerase chain reaction

To determine specificity, the primer pair was tested on total genomic DNA (50 ng for each sample) from 32 other microbial source (bacterial, viral, fungal species and human DNA) [Table 1]. To evaluate the sensitivity of PCR assay, serial dilutions of the total genomic DNA of Aspergillus sp. ranging from 1 pg to 400 ng were prepared and amplified with designed primers as described in [Table 2]. The experiments were repeated at least three times [Figure 2]. The analytical sensitivity of the pan-Aspergillus PCR using the target probe for four medically important Aspergillus species was found to be 102 CFU/mL.
Figure 2: Median cycle threshold values and their standard deviations for all the true positive isolates used in the study. Variation in the mean cycle threshold values and the standard deviations indicate that the fungal species had variation in their post-extraction genomic quantities

Click here to view


Melting curve for the target amplicon of four medically important Aspergillus species with melting point of 85°C

We evaluated whether a subsequent melt curve (Tm) analysis of the full amplicon could discriminate between these three sections. This approach provided us with a characteristic denaturation curve for A. flavus, A. fumigatus, A. niger and A. terreus isolates. Tm analysis was able to distinguish among the four tested medically important Aspergillus sp. [Figure 3]. The analysis of the normalised melting curves of the probe confirmed this distribution (data not shown).
Figure 3: Melting plots obtained in a Tm-multiplexed polymerase chain reaction assay for Aspergillus speciation

Click here to view


Detection of cross-reactivity of species specific Aspergillus primers by melting curve

It is not uncommon to detect the presence of accompanying non-Aspergillus fungal species in specimens containing Aspergillus isolates. To determine the cross-reactivity of the assay and to evaluate potential interferences of these accompanying fungi in accurate identification of Aspergillus, we have tested all four Aspergillus isolates against the desired species specific Aspergillus PCR. All the Ct values were monitored up to 40 cycle of amplification. No cross-reactivity was detected against the desired primers.

Sequence base verification of post-polymerase chain reaction product

Post-PCR sequence based data verified with BLAST search analysis, using each Aspergillus species probe sequence revealed no significant homology with 28s rDNA reference sequences with any unrelated or medically significant fungus for the A. flavus, A. fumigatus, A. niger, A. terreus primers. All the PCR product was sequenced and the data were verified for all four desired Aspergillus sp., and the accession numbers are shown in [Table 2].

This results were also verified with spiked experiment and the result showed that our custom designed probes did not cross-react with DNA from any of the other bacteria, yeasts, molds, or human DNA tested [Table 1].


 ~ Discussion Top


Microbiological identification of IA remains a great challenge till date.[19] Confirmation of the diagnosis of IA often requires obtainment of tissue for histology and culture. Unfortunately, such procedures are often not feasible in immunocompromised patients most of the time due to their poor physical condition.[20] To address the issue, a real-time PCR based identification on blood sample is an important step towards diagnosis of IA in clinical microbiology laboratories because the collection of blood is less invasive than that of BAL fluid or tissue.[21] In this study, we have developed a method for efficient extraction of Aspergillus DNA from four major medically important Aspergillus sp. and two different set of real-time PCR were designed, i.e., pan-Aspergillus PCR and a Aspergillus species-specific real-time PCR.

The comparative analysis of our nucleic acid extraction showed protocol B (heating >freezing >bead beating) had a significantly high DNA yield compared to other tested protocols (P < 0.05). The quality and yield of the extracted DNA from these fungal species were comparable or even higher than a number of previously published fungal DNA extraction methods including automated and manual systems.[14],[22] We tested other fungal species as well following same protocol and accordingly found good recovery of DNA from these human pathogens (data not shown).

As A. fumigatus, A. flavus, A. terreus, A. niger are prevalent Aspergillus species prevalent in our set up, we attempted species specific DNA detection of those species. The results from this study showed that both of our custom design primers (genus and species specific) were efficient, fast and reproducible in the detection of four medically important Aspergillus sp. The analytical sensitivity of the genus specific PCR assay was found to be 102 CFU/mL. The specificity result of the primers and probe showed that our species specific PCR can easily distinguish between four tested Aspergillus sp. Previous studies have shown that certain species of Aspergillus are not easily distinguished by traditional morphological techniques, and typically are identified by DNA sequencing methods.[23] Our β-tubulin gene specific PCR primers can distinguish A. niger, from other species based on the β-tubulin gene sequence. PCR amplification from total DNA using these primers was species specific; no amplification occurred from non-target species DNA for each primer pair. In addition, with these primer sets, each species could be detected in the direct clinical sample following mixed-species inoculation with Aspergillus spores. This indicates that PCR with these species-specific primers and probes may be useful in determining the distribution of Aspergillus species in real clinical samples without the need for species identification from isolated strains, as well as detecting species that may be infrequently isolated by culture-based methods.

Previous studies have showed there are multiple Aspergillus sp PCR based assay were now available for early detection of IA compared to conventional standard assay protocols.[24] Interestingly, studies that used PCR assays of serum yielded higher specificity (85% versus 73%) and lower sensitivity (78% vs. 86%) estimates than those that used whole blood assays, but these differences did not reach statistical significance. It is of note that the average specificity of serum was significantly higher than that of whole blood without bead beating (P = 0.04). Another study by Morrissey et al. showed that the use of PCR along with antigen based assay for the direction of IA reduce the use of empirical antifungal treatment by (17%; P =0.002).[25] This approach is an effective strategy for the management of IA in high-risk hematology patients. A systematic review and multicenter based meta-analysis by Mengoli et al. based on 10,000 samples obtained from 1618 patients also suggest a single PCR-negative result is sufficient to exclude a diagnosis of proven or probable IA. However, two positive tests are required to confirm the diagnosis because the specificity is higher than that attained from a single positive test.[26] In the clinical point of view, several studies by different center showed a specific Aspergillus PCR assay has also been used in the diagnosis of IA and has shown very good results, with a sensitivity and specificity of 100% and 89%, respectively.[27],[28],[29]

Currently, there is a gap of knowledge for a non-culture-based, efficient molecular testing method for the identification of Aspergillus. This is a major limitation, as the mortality of IA increases substantially when the initiation of adequate therapy is delayed.[30] Furthermore, most Aspergillus infections are diagnosed indirectly using GM (or β-1,3-D-glucan) testing, because cultures remain negative in most patients.[31] Therefore, even if limited species specific non-culture-based testing became broadly available, this would be helpful in the early and rapid diagnosis of IA in some patients.

This study was not evaluated in multicenter basis and not tested in real clinical samples which could be the main limitation of this study.


 ~ Conclusion Top


This new two-step real-time PCR allows for a sensitive and rapid detection of Aspergillus species. Furthermore, it can differentiate intra species variation even on culture-negative sample samples. This enables early and targeted therapy in IA patients.

Acknowledgments

This work was supported by the Department of Biotechnology, Government of India (Grant reference number: BT/PR4884/MED/29/394/2012).

We are also grateful to the Department of Microbiology and WHO Collaborating Center for Reference and Research of Fungi of Medical Importance, PGIMER Chandigarh, India, for helping us with external quality assurance, supply of some reference strains from the National Culture Collection of Pathogenic Fungi.

Financial support and sponsorship

The study was supported by the Department of Biotechnology, Government of India (Grant reference number: BT/PR4884/MED/29/394/2012).

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Cornet M, Fleury L, Maslo C, Bernard JF, Brücker G; Invasive Aspergillosis Surveillance Network of the Assistance Publique-Hôpitaux de Paris. Epidemiology of invasive aspergillosis in France: A six-year multicentric survey in the Greater Paris area. J Hosp Infect 2002;51:288-96.  Back to cited text no. 1
    
2.
McNeil MM, Nash SL, Hajjeh RA, Phelan MA, Conn LA, Plikaytis BD, et al. Trends in mortality due to invasive mycotic diseases in the United States, 1980-1997. Clin Infect Dis 2001;33:641-7.  Back to cited text no. 2
    
3.
Chakrabarti A, Chatterjee SS, Das A, Shivaprakash MR. Invasive aspergillosis in developing countries. Med Mycol 2011;49 Suppl 1:S35-47.  Back to cited text no. 3
    
4.
Henry T, Iwen PC, Hinrichs SH. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J Clin Microbiol 2000;38:1510-5.  Back to cited text no. 4
    
5.
Yeo SF, Wong B. Current status of nonculture methods for diagnosis of invasive fungal infections. Clin Microbiol Rev 2002;15:465-84.  Back to cited text no. 5
    
6.
Arvanitis M, Ziakas PD, Zacharioudakis IM, Zervou FN, Caliendo AM, Mylonakis E. PCR in diagnosis of invasive aspergillosis: A meta-analysis of diagnostic performance. J Clin Microbiol 2014;52:3731-42.  Back to cited text no. 6
    
7.
Pfeiffer CD, Fine JP, Safdar N. Diagnosis of invasive aspergillosis using a galactomannan assay: A meta-analysis. Clin Infect Dis 2006;42:1417-27.  Back to cited text no. 7
    
8.
Horvath JA, Dummer S. The use of respiratory-tract cultures in the diagnosis of invasive pulmonary aspergillosis. Am J Med 1996;100:171-8.  Back to cited text no. 8
    
9.
Perfect JR, Cox GM, Lee JY, Kauffman CA, de Repentigny L, Chapman SW, et al. The impact of culture isolation of Aspergillus species: A hospital-based survey of aspergillosis. Clin Infect Dis 2001;33:1824-33.  Back to cited text no. 9
    
10.
De Pauw B, Walsh TJ, Donnelly JP, Stevens DA, Edwards JE, Calandra T, et al. Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin Infect Dis 2008;46:1813-21.  Back to cited text no. 10
    
11.
Thornton C, Johnson G, Agrawal S. Detection of invasive pulmonary aspergillosis in haematological malignancy patients by using lateral-flow technology. J Vis Exp 2012. pii: 3721.  Back to cited text no. 11
    
12.
Guo YL, Chen YQ, Wang K, Qin SM, Wu C, Kong JL. Accuracy of BAL galactomannan in diagnosing invasive aspergillosis: A bivariate metaanalysis and systematic review. Chest 2010;138:817-24.  Back to cited text no. 12
    
13.
Balajee SA, Nickle D, Varga J, Marr KA. Molecular studies reveal frequent misidentification of Aspergillus fumigatus by morphotyping. Eukaryot Cell 2006;5:1705-12.  Back to cited text no. 13
    
14.
Fredricks DN, Smith C, Meier A. Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR. J Clin Microbiol 2005;43:5122-8.  Back to cited text no. 14
    
15.
Zhang D, Yang Y, Castlebury LA, Cerniglia CE. A method for the large scale isolation of high transformation efficiency fungal genomic DNA. FEMS Microbiol Lett 1996;145:261-5.  Back to cited text no. 15
    
16.
Müller FM, Werner KE, Kasai M, Francesconi A, Chanock SJ, Walsh TJ. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption. J Clin Microbiol 1998;36:1625-9.  Back to cited text no. 16
    
17.
Kosmidis C, Denning DW. Republished: The clinical spectrum of pulmonary aspergillosis. Postgrad Med J 2015;91:403-10.  Back to cited text no. 17
    
18.
Sivasankari S, Senthamarai S, Anitha C, Sastry AS, Bhatt S, Kumudhavati MS, Amshavathani SK. Prevalence of Invasive Aspergillosis Among (PTB) Patients in Kanchipuram, India. J Clin Diagn Res 2014;8:22-3.  Back to cited text no. 18
    
19.
Marr KA, Leisenring W. Design issues in studies evaluating diagnostic tests for aspergillosis. Clin Infect Dis 2005;41 Suppl 6:S381-6.  Back to cited text no. 19
    
20.
O'Sullivan CE, Kasai M, Francesconi A, Petraitis V, Petraitiene R, Kelaher AM, et al. Development and validation of a quantitative real-time PCR assay using fluorescence resonance energy transfer technology for detection of Aspergillus fumigatus in experimental invasive pulmonary aspergillosis. J Clin Microbiol 2003;41:5676-82.  Back to cited text no. 20
    
21.
Espy MJ, Uhl JR, Sloan LM, Buckwalter SP, Jones MF, Vetter EA, et al. Real-time PCR in clinical microbiology: Applications for routine laboratory testing. Clin Microbiol Rev 2006;19:165-256.  Back to cited text no. 21
    
22.
Rittenour WR, Park JH, Cox-Ganser JM, Beezhold DH, Green BJ. Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing. J Environ Monit 2012;14:766-74.  Back to cited text no. 22
    
23.
Palumbo JD, O'Keeffe TL. Detection and discrimination of four Aspergillus section Nigri species by PCR. Lett Appl Microbiol 2015;60:188-95.  Back to cited text no. 23
    
24.
Arvanitis M, Mylonakis E. Diagnosis of invasive aspergillosis: Recent developments and ongoing challenges. Eur J Clin Invest 2015;45:646-52.  Back to cited text no. 24
    
25.
Morrissey CO, Chen SC, Sorrell TC, Milliken S, Bardy PG, Bradstock KF, et al. Galactomannan and PCR versus culture and histology for directing use of antifungal treatment for invasive aspergillosis in high-risk haematology patients: A randomised controlled trial. Lancet Infect Dis 2013;13:519-28.  Back to cited text no. 25
    
26.
Mengoli C, Cruciani M, Barnes RA, Loeffler J, Donnelly JP. Use of PCR for diagnosis of invasive aspergillosis: Systematic review and meta-analysis. Lancet Infect Dis 2009;9:89-96.  Back to cited text no. 26
    
27.
White PL, Bretagne S, Klingspor L, Melchers WJ, McCulloch E, Schulz B, et al. Aspergillus PCR: One step closer to standardization. J Clin Microbiol 2010;48:1231-40.  Back to cited text no. 27
    
28.
Einsele H, Hebart H, Roller G, Löffler J, Rothenhofer I, Müller CA, et al. Detection and identification of fungal pathogens in blood by using molecular probes. J Clin Microbiol 1997;35:1353-60.  Back to cited text no. 28
    
29.
Van Burik JA, Myerson D, Schreckhise RW, Bowden RA. Panfungal PCR assay for detection of fungal infection in human blood specimens. J Clin Microbiol 1998;36:1169-75.  Back to cited text no. 29
    
30.
Lin SJ, Schranz J, Teutsch SM. Aspergillosis case-fatality rate: Systematic review of the literature. Clin Infect Dis 2001;32:358-66.  Back to cited text no. 30
    
31.
Chong GL, van de Sande WW, Dingemans GJ, Gaajetaan GR, Vonk AG, Hayette MP, et al. Validation of a new Aspergillus real-time PCR assay for direct detection of Aspergillus and azole resistance of Aspergillus fumigatus on bronchoalveolar lavage fluid. J Clin Microbiol 2015;53:868-74.  Back to cited text no. 31
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04