Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 266 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (718 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~  Discussion and C...
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed387    
    Printed26    
    Emailed0    
    PDF Downloaded145    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 35  |  Issue : 2  |  Page : 247-251
 

Resurgence of diphtheria in rural areas of North Karnataka, India


1 Department of Microbiology, Belagavi Institute of Medical Sciences, Belagavi, Karnataka, India
2 Regional Medical Research Centre, ICMR, Department of Health Research, Govt of India, Belagavi, Karnataka, India

Date of Web Publication5-Jul-2017

Correspondence Address:
Subarna Roy
Regional Medical Research Centre, ICMR, Department of Health Research, Belagavi - 590 010, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijmm.IJMM_17_48

Rights and Permissions

 ~ Abstract 

Background: A diphtheria outbreak was identified from Vijayapura (formerly Bijapur) district in the South Indian state of Karnataka in 2011. There was a surge in the number of throat swab samples received under the Integrated Disease Surveillance Programme (IDSP) in North Karnataka since then. Objectives: A microbiological study was undertaken to generate information on the status of resurgence of the disease in the region. Materials and Methods: Throat swabs from 432 suspected cases of diphtheria during 2012–2015 were obtained from government hospitals and primary health centres of 8 districts in North Karnataka and were processed for the culture and identification of Corynebacterium diphtheriae. Polymerase chain reaction for the presence of toxin gene (toxA and toxB) was carried out on the isolates. Antibiotic sensitivity tests were performed on the isolates with a panel of 14 antibiotics. Results: Thirty-eight (8.79%) out of 432 samples yielded C. diphtheriae on culture. All isolates possessed the diphtheria toxin gene. Out of the 38 confirmed cases, whereas 21 (55.26%) were between 1 and 5 years of age, 14 (36.84%) were aged between 5 and 10 years. Male children were three times more than females in confirmed cases. No information was available on the immunisation status of the cases. Emergence of resistance to penicillin was found with minimum inhibitory concentration reaching up to 6.00 μg/ml. Conclusion and Discussion: Our study identified an upsurge in cases of diphtheria in North Karnataka, particularly in Vijayapura District, and to the best of our knowledge, reports the emergence of penicillin resistance for the first time in India. The study calls for enhanced surveillance for the disease, making antidiphtheritic serum available in key hospitals in the region and serves to provide a baseline for future assessment of the impact of the recently launched 'Mission Indradhanush' programme in strengthening Universal Immunisation Programme (UIP).


Keywords: Diphtheria, epidemiology, immunisation, outbreak


How to cite this article:
Parande MV, Roy S, Mantur B G, Parande AM, Shinde RS. Resurgence of diphtheria in rural areas of North Karnataka, India. Indian J Med Microbiol 2017;35:247-51

How to cite this URL:
Parande MV, Roy S, Mantur B G, Parande AM, Shinde RS. Resurgence of diphtheria in rural areas of North Karnataka, India. Indian J Med Microbiol [serial online] 2017 [cited 2017 Sep 26];35:247-51. Available from: http://www.ijmm.org/text.asp?2017/35/2/247/209596



 ~ Introduction Top


Diphtheria is an infectious disease caused by Gram-positive facultatively anaerobic bacilli Corynebacterium diphtheriae. It is an upper respiratory tract infection involving anterior nasal, pharyngeal, tonsillar or laryngeal mucous membranes. The mortality rate, which is generally 5%–10%, may be as high as 20% in children below 5 years and adults over 40 years of age.[1] Incidence of the disease, which was more than a million per year during the first half of the 19th century declined by over 95% during the past three decades due to widespread immunisation.[2] However, after this sharp decline in cases, there seems to be a plateau in the world incidence of the disease with India contributing as much as 78% of all cases. Due to the vaccine preventable nature of the disease and initial steady decline, not much attention has been given towards this disease which has not only continued over the past decade in India but has also been sixth in the list with highest mortality rate in India. Current statistics show that diphtheria has been reemerging.[3],[4] This reemergence is despite a reported increase in coverage of the Universal Immunisation Programme (UIP). The National Health Profiles indicate that India reported 5826, 2834, 3812, 3977, 3529, 3434, 4233, 2525, 3133 and 6094 cases of diphtheria and 68, 66, 69, 70, 122, 159, 99, 60, 64 and 104 deaths, respectively, during 2005–2014.[3] Certainly, this information is a compilation of the data which is mostly limited to reports obtained from routine surveillance systems functioning in respective states and union territories in the country. Detailed literature on occurrence of diphtheria as cases or outbreaks has been very scanty. Literature that is available include those cases and outbreaks of diphtheria that occurred in Delhi and adjoining states,[5] in urban slums in North India,[6] Assam in North East India,[7] Mumbai,[8] parts of Maharashtra in Western India,[9] Hyderabad [3] and Pondicherry [10] in South India. The only study available from Karnataka is a case report of a patient from Hubballi [11] and the description of an outbreak occurring from a remote village in Vijayapura district in 2011.[12] The present health statistics and data from the few studies that have been carried out suggest that the fight against diphtheria in India is far from being over.

The present study carried out in one of the government medical colleges in the state of Karnataka in South India reports the recent rise in suspected and confirmed cases of diphtheria in North Karnataka in an attempt to flag the disease as a silent killer and to underscore the importance of achieving complete victory over this vaccine preventable disease.


 ~ Materials and Methods Top


Samples

Since the occurrence of a diphtheria outbreak was first reported in 2011 from the region,[12] the IDSP Centre at the Belagavi Institute of Medical Sciences, Belagavi, received a total of 432 throat swab samples for confirmation, from suspected cases of diphtheria from various district hospitals and government health centers spread over eight districts in North Karnataka in South West India [Figure 1], from 2012 to 2015.
Figure 1: Representational map of the study area in the State of Karnataka, India

Click here to view


Microbiological tests

Albert's staining of swab smears was carried out and isolation of Corynebacterium spp. was attempted on Hoyle's tellurite lysed blood agar [13] from all the throat swab samples collected. Cultures were also made on Loeffler's serum slope for observation of pleomorphism, if any, after 4–6 h of incubation.

Polymerase chain reaction assay for tox gene

Genomic DNA of all the bacterial strains was isolated following cetyltrimethylammonium bromide method [14] and quantified spectrophotometrically (Nanodrop, JH Bio, USA).

Polymerase chain reaction (PCR) was carried out with samples of genomic DNA to detect the toxigenic gene fragments toxA and toxB following published protocol.[15] Two sets of primers targeting the A and B subunits of the diphtheria toxin gene were used. Primers Tox 1 (5'ATCCACTTTTAGTGCGAGAACCTTCGTCA3') and Tox 2 (5'GAAAACTTTTCTTCGTACCACGGGACTAA3') amplifying 248 bp of A subunit and primers Dipht 6F (5'ATACTTCCTGGTATCGGTAGC3') and Dipht 6R (5'CGAATCTTCAACAGTGTTCCA3') amplifying 297 bp of B subunit were used in PCR amplifications performed in BioRad CFX96 Thermal Cycler (BioRad, USA). Reactions were carried out in 25 μl volumes with 25 ng of template DNA, 2 μm each primer, 250 μm of each dNTPs, 1.5 mM MgCl2 and 0.5 U of Taq DNA polymerase in 10 mM Tris–HCl (pH 9.0) and 50 mM KCl. The mixture was initially denatured at 95°C for 2 min, followed by 35 amplification cycles of 95°C for 20 s, 55°C for 30 s and 72°C for 1 min, ending with a final 10-min extension at 72°C. Reaction products were stained with GelRed (Biotium Inc., USA), electrophoresed in 1% agarose gels and documented using a G-Box F3 Gel Documentation System (Syngene, UK).

Antibiotic sensitivity testing

Antibiogram was generated for each isolate by carrying out Kirby–Bauer disk diffusion method [16] using a panel of 14 antibiotic discs (HiMedia, Mumbai, India) on Mueller-Hinton agar plates and following CLSI guidelines.[17] Minimum inhibitory concentration (MIC) of isolates that has been maintained in the laboratory were determined using Ezy MIC strip™ (HiMedia, Mumbai, India) following manufacturer's instructions.


 ~ Results Top


Amongst the 432 throat swabs tested, 38 (8.79%) were culture positive for C. diphtheriae. All 38 isolates showed the presence of both A and B subunits of the diphtheria toxin gene in PCR assays confirming that these strains were toxigenic C. diphtheriae. Year-wise distribution of suspected and confirmed cases is shown in [Table 1]. The number of suspected and confirmed cases was found to have increased remarkably in 2014 and 2015.
Table 1: Year-wise distribution of clinically suspected cases of diphtheria and laboratory confirmed cases

Click here to view


Whilst the majority of suspected and confirmed cases came from Vijayapura district, Bagalkote, Belagavi and Yadgir districts were also confirmed to be diphtheria hit. Although there were suspected cases from the four other districts, namely, Kalaburgi, Koppal, Gadag and Raichur, it could not be confirmed by the tests employed in the study [Table 2].
Table 2: District-wise distribution of clinically suspected and laboratory confirmed cases from 2012 to 2015

Click here to view


Whilst most of the confirmed cases (21; 55.26%) belonged to the 1–5 year age group, a significant number of cases (14; 36.84%) were between 6 and 10 years. There were no confirmed cases in the age group below 1 year or over 15 years of age. Interestingly, the confirmed cases in males were three times higher than in females [Table 3]. Mortality data of the patients was not available.
Table 3: Age and sex distribution of the confirmed cases of diphtheria

Click here to view


At least 10 types of antibiograms were observed in the 38 isolates obtained suggesting the circulation of varied types of strains of C. diphtheriae [Table 4]. Penicillin resistance was observed in 33 (86.84%) of 38 isolates and the strain carrying resistance to only penicillin was the most common accounting for 21 (55.26%) of the 38 strains isolated over the years. MIC of penicillin ranged from 0.047 to 6.00 μg/ml for 5 strains on which Ezy MIC™ test was performed [Figure 2]. Resistance to co-trimoxazole was also observed in 12 (31.58%) of 38 isolates. Resistance to ampicillin, gentamicin and erythromycin was observed only in 1 (2.6%), isolate each. Whilst resistance to penicillin is an important observation, it was also interesting to note emergence of resistance to macrolides (azithromycin) and newer fluoroquinolone (ciprofloxacin) in 2 (5.26%) of the isolates.
Table 4: Antibiogram of Corynebacterium diphtheriae isolates by disc diffusion test

Click here to view
Figure 2: Minimum inhibitory concentration of two strains of Corynebacterium diphtheriae showing different levels of resistance (a: high; b: low) to penicillin on Ezy MIC™

Click here to view



 ~ Discussion and Conclusion Top


Diphtheria, if not detected early and treated promptly with antibiotics and antidiphtheritic serum (ADS), can lead to significant mortality and morbidity because of critical complications such as myocarditis, obstructive airway disease, polyneuritis, cranial nerve palsies, disseminated intravascular coagulation and secondary pneumonia.[18] The Indian state of Karnataka experienced rapid decline in cases of diphtheria along with rest of India and the world as a result of vaccination during the greater part of the past three decades. It reported only 12 cases with no death since 2007. No case was even reported in 2010.[3] However, since 2011, a number of cases had been reported following an outbreak which occurred in the district of Vijayapura, formerly known as Bijapur.[12] As outlined in [Table 1] and [Table 3], this district contributed to a large majority of suspected cases in North Karnataka since then and undoubtedly has become the 'hot bed' of diphtheria resurgence in the region. The extent to which Vijayapura district is affected is evident from the fact that in the year 2013, it reported 3 of the 5 cases from the entire state of Karnataka while in 2014 it reported 21 of the 56 cases that were reported by the state.[3] From the present study, it is evident that the adjoining Bagalkote and Belagavi districts had also been reporting cases of diphtheria following the upsurge in Vijayapura district. These districts, being sensitised and made aware of the occurrence of diphtheria in neighbouring Vijayapura district had been seeking confirmed diagnosis through the IDSP. In the present study, all the 38 isolates obtained from the 432 suspected samples were toxA and toxB positive in PCR meaning that they are capable of producing the diphtheria toxin and therefore potentially lethal. Although a few isolates were subjected to PCR and sequencing of rDNA for confirmation, ELEK's test was not performed and no attempt was made to sequence characterise the rpoB, gene, the data presented here provides some insight into cases of diphtheria and should be enough to flag the issue of rising diphtheria infections in the region. The low isolation and confirmation rate might be due to the long-time taken for transportation of samples to the IDSP centre at Belagavi and lack of requisite expertise and resources at collection sites, most of which are in far-flung rural areas. Although predominance (55%) of one antibiogram (Type II in [Table 4]) indicates that a particular strain might be more actively spreading than the others, the presence of at least 9 other antibiograms indicate that there are quite a large number of different strains that are in circulation across the region. It is therefore logical to infer that either there are multiple pockets of outbreak or the disease is occurring as sporadic events in various locations. Continuation of the occurrence for the past 4 to 5 years is suggestive of the likelihood of the disease becoming once again endemic to the region and therefore needs to be controlled quickly. Although antibiotic sensitivity was carried out mainly to detect variations and change in susceptibility patterns of isolates over space and time, the emergence of resistance to penicillin, is to the best of our knowledge, being reported for the first time from India. In the absence of standardised breakpoints for C. diphtheriae, sensitivity to antimicrobials was assessed using the criteria for Streptococcus spp. other than Streptococcus pneumoniae as done previously.[19] Resistance to fluoroquinolones and macrolides, although in small number of isolates, is also a matter of concern, which might have resulted from these strains acquiring resistance due to indiscriminate use of these antibiotics in treating infections of the upper respiratory tract in this region over the years. Another important finding in the study is the large proportion of relatively older children between 6 and 10 years of age getting infected with diphtheria and therefore clinicians should keep the disease in mind whilst making a differential diagnosis. The very high proportion of males getting infected with diphtheria than females may be attributed to the fact that in rural areas, boys are more engaged in outdoor activities, thereby coming in contact with infected cases more than their female counterparts.

Since antibiotic therapy eliminates the infection but cannot reverse the effect of the diphtheria toxin, our study calls for the urgent need of making ADS available at key hospitals and health centres in the region to reduce mortality. Although in the absence of information on the immunisation status of the participants, it is not possible to draw a conclusion on the performance of immunisation; the Government of India, taking cognizance of the urgent requirement of strengthening the UIP, and in tune with the advocacy made by Parande et al. 2014 during the 2011 outbreak of diphtheria in Vijayapura, has launched Mission Indradhanush in December 2014 to increase immunisation coverage against 7 diseases including diphtheria, from approximately 65% to at least 90% in eligible children.[20] Apart from the advocacy for enhanced surveillance and making a case for ADS availability in the region, our study provides a baseline for future assessment of the impact of Mission Indradhanush on diphtheria cases from the northern districts of Karnataka.

Acknowledgements

The authors are thankful to the Indian Council of Medical Research for supporting this study as an outbreak response through the intramural funds of RMRC, Belagavi. The authors also gratefully acknowledge the services of the Bio-Medical Informatics Centre of ICMR at RMRC Belagavi for data analysisand trainee Ms. Sampada Singanalli for technical assistance' at the end of the paragraph after 'analysis'.

Financial support and sponsorship

The study was supported by the internal funds of IDSP of Belagavi Institute of Medical Sciences, Belagavi and Regional Medical Research Centre, ICMR, Belagavi.

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Atkinson W, Hamborsky J, McIntyre L, Wolfe S, editors. Diphtheria. In: Epidemiology and Prevention of Vaccine-preventable Diseases. 10th ed. Washington, DC: Public Health Foundation; 2007. p. 59-70.  Back to cited text no. 1
    
2.
World Health Organization. Immunization Surveillance, Assessment and Monitoring: Data, Statistics and Graphics. Available from: http://www.who.int/entity/immunization_monitoring/data/incidence_series.xls. [Last accessed on 2012 Sep 01].  Back to cited text no. 2
    
3.
Central Bureau of Health Intelligence, Directorate General of Health Services, Government of India. National Health Profiles; 2011. Available from: http://www.cbhidghs.nic.in/index1.asp?linkid=267. [Last accessed on 2016 Dec 31].  Back to cited text no. 3
    
4.
Bitragunta S, Murhekar MV, Hutin YJ, Penumur PP, Gupte MD. Persistence of diphtheria, Hyderabad, India, 2003-2006. Emerg Infect Dis 2008;14:1144-6.  Back to cited text no. 4
[PUBMED]    
5.
Sharma NC, Banavaliker JN, Ranjan R, Kumar R. Bacteriological and epidemiological characteristics of diphtheria cases in and around Delhi – A retrospective study. Indian J Med Res 2007;126:545-52.  Back to cited text no. 5
[PUBMED]  [Full text]  
6.
Lodha R, Dash NR, Kapil A, Kabra SK. Diphtheria in urban slums in North India. Lancet 2000;355:204.  Back to cited text no. 6
    
7.
Nath B, Mahanta TG. Investigation of an outbreak of diphtheria in borborooah block of dibrugarh district, Assam. Indian J Community Med 2010;35:436-8.  Back to cited text no. 7
[PUBMED]  [Full text]  
8.
Khan N, Shastri J, Aigal U, Doctor B. Resurgence of diphtheria in the vaccination era. Indian J Med Microbiol 2007;25:434.  Back to cited text no. 8
[PUBMED]  [Full text]  
9.
Dravid MN, Joshi SA. Resurgence of diphtheria in Malegaon and Dhule regions of North Maharashtra. Indian J Med Res 2008;127:616-7.  Back to cited text no. 9
[PUBMED]  [Full text]  
10.
Sashikala P, Vivek Reddy PV, Prashanth K, Kanungo R, Devi S, Anitha P, et al. Persistence of non-toxigenic Corynebacterium diphtheriae biotype gravis strains in Pondicherry, Southern India. J Clin Microbiol 2011;49:763.  Back to cited text no. 10
    
11.
Raza SA, Nagalotimath U, Achar K. Diphtheria in an adult: How well prepared are we in tackling the disease? A case report. Indian J Otolaryngol Head Neck Surg 2011;63:289-91.  Back to cited text no. 11
    
12.
Parande MV, Parande AM, Lakkannavar SL, Kholkute SD, Roy S. Diphtheria outbreak in rural North Karnataka, India. JMM Case Rep 2014;1:1-3. [Doi: 10.1099/jmmcr.0.003558].  Back to cited text no. 12
    
13.
Zamiri I. Corynebacterium. In: Collee JG, Fraser AG, Marmion DP, Simmons A, editors. Mackie & Mccartney. Practical Medical Microbiology. 14th ed. India: Elsevier Health Sciences; 1996. p. 299-308.  Back to cited text no. 13
    
14.
Ausubel FM, Brent R, Kingston RE, Moore DD. Short Protocols in Molecular Biology. 4th ed. New York: John Wiley and Sons Inc.; 1999.  Back to cited text no. 14
    
15.
Nakao H, Popovic T. Development of a direct PCR assay for detection of the diphtheria toxin gene. J Clin Microbiol 1997;35:1651-5.  Back to cited text no. 15
    
16.
Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45:493-6.  Back to cited text no. 16
    
17.
Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Susceptibility Tests. Approved Standard M2-A10. Wayne, PA: Clinical and Laboratory Standards Institute; 2014.  Back to cited text no. 17
    
18.
Meera M, Rajarao M. Diphtheria in Andhra Pradesh – A clinical-epidemiological study. Int J Infect Dis 2014;19:74-8.  Back to cited text no. 18
    
19.
von Hunolstein C, Scopetti F, Efstratiou A, Engler K. Penicillin tolerance amongst non-toxigenic Corynebacterium diphtheriae isolated from cases of pharyngitis. J Antimicrob Chemother 2002;50:125-8.  Back to cited text no. 19
    
20.
National Health Portal, Government of India; 2016. Available from: http://www.nhp.gov.in/1mission-indradhanush_pg. [Last accessed on 2016 Dec 31].  Back to cited text no. 20
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04