|
 
 |
| BRIEF COMMUNICATION |
|
|
|
| Year : 2017 | Volume
: 35
| Issue : 1 | Page : 137-139 |
| |
Carbapenem nonsusceptibility with modified OprD in clinical isolates of Pseudomonas aeruginosa from India
Debarati Choudhury1, Anupam Das Talukdar1, Manabendra Dutta Choudhury1, Anand Prakash Maurya2, Debadatta Dhar Chanda3, Atanu Chakravorty3, Amitabha Bhattacharjee2
1 Department of Life Science and Bioinformatics, Assam University, Silchar, Assam, India
2 Department of Microbiology, Assam University, Silchar, Assam, India
3 Department of Microbiology, Silchar Medical College and Hospital, Silchar, Assam, India
| Date of Web Publication | 16-Mar-2017 |
Correspondence Address:
Amitabha Bhattacharjee
Department of Microbiology, Assam University, Silchar - 788 011, Assam
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/ijmm.IJMM_15_220
This study was undertaken to investigate OprD porin-mediated carbapenem nonsusceptibility in clinical isolates of Pseudomonas aeruginosa from a tertiary referral hospital of Northeast India. A total of 267 nonduplicate, consecutive clinical isolates of P. aeruginosa were obtained. Mutation and expression levels of OprD gene were determined in carbapenem-nonsusceptible carbapenemase-nonproducing isolates. Among 19 carbapenem-nonsusceptible carbapenemase-nonproducing isolates, 11 of them demonstrated variable band pattern while performing denaturing gradient gel electrophoresis with amplified products of OprD gene. Sequencing of variable band products revealed three mutation patterns in three isolates. Relevant decrease in expression of OprD gene could also be observed in them. All the three isolates exhibited a higher minimum inhibitory concentration for imipenem (64–128 μg/mL) compared to meropenem (16–64 μg/mL). Inactivating mutation and decreased expression of OprD contribute mainly to imipenem resistance as well as to meropenem.
Keywords: Carbapenem, OprD, Pseudomonas aeruginosa
How to cite this article:
Choudhury D, Talukdar AD, Choudhury MD, Maurya AP, Chanda DD, Chakravorty A, Bhattacharjee A. Carbapenem nonsusceptibility with modified OprD in clinical isolates of Pseudomonas aeruginosa from India. Indian J Med Microbiol 2017;35:137-9 |
How to cite this URL:
Choudhury D, Talukdar AD, Choudhury MD, Maurya AP, Chanda DD, Chakravorty A, Bhattacharjee A. Carbapenem nonsusceptibility with modified OprD in clinical isolates of Pseudomonas aeruginosa from India. Indian J Med Microbiol [serial online] 2017 [cited 2019 Dec 15];35:137-9. Available from: http://www.ijmm.org/text.asp?2017/35/1/137/202321 |
Multidrug-resistant Pseudomonas aeruginosa has become a severe global threat for the treatment of both community-acquired and nosocomial infection.[1] Carbapenems are predominantly used in empirical therapy of infection caused by multidrug-resistant P. aeruginosa, but the development of resistance to this particular group of drugs has confined the treatment options to a great extent leaving colistin as only option in such situation.[2] It has been reported that in the absence of acquired carbapenem-resistant determinants, alteration of OprD contributes significantly to resistance.[3] However, role of intrinsic mechanism in carbapenem resistance is still not available from this region of the world. Hence, this study was undertaken to gain an insight into the OprD porin-mediated carbapenem nonsusceptibility in clinical isolates of P. aeruginosa, which lack carbapenemases from a tertiary referral hospital of Northeastern part of India.
The samples for the present study were collected from the patients who were admitted to wards or attended outpatient department of Silchar Medical College and Hospital, Silchar, India, from March, 2013 to February, 2014 for 1 year. During this period, 267 nonduplicate, consecutive clinical isolates of P. aeruginosa were collected. Antibiotic susceptibility testing was performed by Kirby–Bauer disc diffusion method against antibiotics, namely, imipenem (10 µg), meropenem (10 µg), ciprofloxacin (5 µg), amikacin (30 µg), gentamycin (10 µg), carbenicillin (10 µg), polymixin B (300 µg), ceftazidime (30 µg), piperacillin-tazobactam (100/10 µg) (Himedia, Mumbai, India). Minimum inhibitory concentration (MIC) was performed against imipenem and meropenem by agar dilution method and the results were interpreted as per the Clinical and Laboratory Standards Institute guidelines.[4] Carbapenem-nonsusceptible P. aeruginosa isolates were selected on the basis of resistance to imipenem. Carbapenem-nonsusceptible P. aeruginosa isolates were subjected to modified Hodge test for detection of carbapenemase production.[5] To confirm the absence of carbapenemase genes, polymerase chain reaction (PCR) assay was performed for detection of various carbapenemase genes blaVIM, blaNDM, blaIMP, blaOXA-48, blaOXA-23, -24/40 and -58.[6],[7],[8],[9] Imipenem nonsusceptible carbapenemase negative isolates were screened for existence of OprD gene using OprD gene-specific primers (forward primer: CGGCGACATCAGCAACACC and reverse primer: GGGCCGTTGAAGTCGGAGTA).[5] The reaction condition was 2 min at 95°C; 34 cycles of 20 s at 95°C, 45 s at 60°C, 1 min at 72°C and finally, 3 min at 72°C. The amplified products were analysed by 1% (w/w) agarose gel electrophoresis and were visualised after staining with ethidium bromide. Mutation in the OprD gene was identified by denaturing gradient gel electrophoresis (DGGE). The products showing variations in DGGE were sequenced, analysed and compared with that of the reference strain P. aeruginosa PAO1 (GenBank accession no. CAA78448). Expression of OprD gene was determined by quantitative real-time PCR as described previously with some modification.[5] Reduced OprD expression was considered significant when it was ≤30% compared with that of P. aeruginosa PAO1.[5] REP PCR was performed to determine clonal relatedness of all the imipenem-nonsusceptible isolates.[10]
Among 267 P. aeruginosa isolates, 63 were resistant and above breakpoint level for both imipenem and meropenem [Table 1]. Among these 63 carbapenem-nonsusceptible isolates, carbapenemase activity was absent in 19 of them and multiplex PCR could not establish the presence of carbapenemase genes in the isolates. All the imipenem-resistant carbapenemase-nonproducing isolates were of multidrug-resistant phenotype and Polymixin B came up with moderate activity. | Table 1: Minimum inhibitory concentration 50 and minimum inhibitory concentration 90 of carbapenem-resistant Pseudomonas aeruginosa isolates
Click here to view |
Visible amplification with targeted OprD region was observed in all the 19 carbapenem-nonsusceptible carbapenemase-nonproducing isolates, whereas variation in band pattern was noticed in 11 of them while performing DGGE with amplified products. All the 11 variable band patterns were further sequenced and compared with that of PAO1 to establish three patterns of mutation in three isolates (Pattern 1: PA594, Pattern 2: PA274 and Pattern 3: PA523). PA594 displayed a gap of 3 bp and point mutation of 14 bp. Protein sequence alignment of OprD porin (www.ncbi.nlm.nih.gov/BLAST) from PA594 with that of PAO1 rather revealed an interesting result. OprD porin of PA594 shared only 77% homology with that of PAO1. PA274 showed point mutation of 20 bp and 1 bp gap, whereas PA 523 exhibited a gap of 2 bp and point mutation of 21 bp. OprD protein sequences of PA 274 and PA 523 share 92% and 91% homology with that of PAO1, respectively. All the three isolates had a significant decrease in OprD expression (≤30%) in comparison to that of P. aeruginosa PAO1 [Figure 1]. REP PCR revealed that all the test isolates were clonally nonrelated. | Figure 1: Comparison between OprD expression in Pseudomonas aeruginosa PAO1 and in imipenem-resistant isolates by semiquantitative and quantitative real-time polymerase chain reaction. Results for quantitative real-time polymerase chain reaction are expressed relative to the amount of OprD in the PAO1. Standard deviations for duplicate determinations were below 15? of the mean in two experiments. Imipenem and meropenem susceptibility levels expressed as minimum inhibitory concentration values
Click here to view |
Carbapenems, such as imipenem and meropenem, are considered as the most effective therapeutic options in infections caused by multidrug-resistant P. aeruginosa.[11] Carbapenem resistance may emerge due to prolonged exposure and may involve various mechanisms. Various mechanisms are being reported for carbapenem resistance while majority of the studies focused on resistance due to the production of carbapenemases. Recently, Carba NP test is introduced which is a simple and rapid test to detect carbapenemase-mediated resistance.[12] Thus, there is a need to focus on intrinsic resistance mechanisms, especially porin alteration which also confers significant imipenem resistance. As very little data are available from this part of the country, so this study was undertaken to investigate the role of porin-based intrinsic mechanism in conferring carbapenem resistance.
Among 11 isolates with variable DGGE band patterns, inactivating mutations were found to be present in OprD gene of three isolates (PA594, PA274 and PA523) which were further confirmed by sequence analysis. Protein sequence alignment of the target region revealed variation in amino acids. Although amino acid changes are not related with expression of OprD, it might lead to loss of function of OprD which explains high MIC for these isolates. PA594 with only 77% homology with that of PAO1 exhibited MIC of 128 µg/mL for imipenem whereas PA274 and PA523 shared 91% and 92% homology, respectively, along with their MIC value being 64 µg/mL towards imipenem. All the three isolates exhibited a higher MIC for imipenem (64–128 µg/mL) compared to meropenem (16–64 µg/mL) [Figure 1]. Inactivating mutation and decreased expression of OprD contribute mainly to imipenem resistance, whereas additional mechanisms, such as overexpresssion of MexAB-OprM efflux pump or AmpC β-lactamases are needed for resistance to meropenem.[13] The findings clearly indicate that inactivating mutation in OprD significantly confers resistance to imipenem but a lesser extent to meropenem.
This study demonstrated that, besides carbapenemase-mediated resistance, alteration in outer membrane porin, OprD can significantly augment imipenem resistance in nosocomial isolates of P. aeruginosa in hospital settings. Although their detection requires sophisticated equipment and trained human resource, information about this intrinsic mechanism may aid in selection of appropriate carbapenem for the treatment of P. aeruginosa and their management as well.
Acknowledgement
We would like to acknowledge the help from Assam University Biotech Hub for providing laboratory facility to complete this work. We also acknowledge the help of HOD, Microbiology, Assam University, for providing infrastructure. We also acknowledge financial help from University Grants commission in form of Basic Scientific research fellowship. We are indebted to Prof. K. Poole, Queens University, Canada, for providing strain, P. aeruginosa PAO1.
Financial support and sponsorship
The study was supported by the Department of Biotechnology (DBT), Government of India (Assam University Institutional Biotech Hub [BT/04/NE/2009] and DBT-NER twining (BCIL/NER-BPMC/2014-203)).
Conflicts of interest
There are no conflicts of interest.
| ~ References | |  |
| 1. | Lee JY, Ko KS. OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-ß-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. Int J Antimicrob Agents 2012;40:168-72.  |
| 2. | Naenna P, Noisumdaeng P, Pongpech P, Tribuddharat C. Detection of outer membrane porin protein, an imipenem influx channel, in Pseudomonas aeruginosa clinical isolates. Southeast Asian J Trop Med Public Health 2010;41:614-24. |
| 3. | Wolter DJ, Hanson ND, Lister PD. Insertional inactivation of oprD in clinical isolates of Pseudomonas aeruginosa leading to carbapenem resistance. FEMS Microbiol Lett 2004;236:137-43. |
| 4. | Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement; M100-S21. Wayne, PA, USA: CLSI; 2001. |
| 5. | Tomás M, Doumith M, Warner M, Turton JF, Beceiro A, Bou G, et al. Efflux pumps, OprD porin, AmpC beta-lactamase, and multiresistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Antimicrob Agents Chemother 2010;54:2219-24. |
| 6. | Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-beta-lactamase gene, bla (NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 2009;53:5046-54. |
| 7. | Yum JH, Yi K, Lee H, Yong D, Lee K, Kim JM, et al. Molecular characterization of metallo-etlacatamase-producing Acinetobacter baumannii and Acinetbacter genomospecies 3 from Korea: Identification of two new integrons carrying the blaVIM-2 gene cassettes. J Antimicrob Chemother 2002;49:837-40. |
| 8. | Shibl A, Al-Agamy M, Memish Z, Senok A, Khader SA, Assiri A. The emergence of OXA-48- and NDM-1-positive Klebsiella pneumoniae in Riyadh, Saudi Arabia. Int J Infect Dis 2013;17:e1130-3. |
| 9. | Mendes RE, Bell JM, Turnidge JD, Castanheira M, Jones RN. Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. in Asia-Pacific nations: Report from the SENTRY Surveillance Program. J Antimicrob Chemother 2009;63:55-9. |
| 10. | Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 1991;19:6823-31. |
| 11. | Wang CX, Mi ZH. Imipenem-resistant Pseudomonas aeruginosa producing IMP-1 metallo-beta-lactamases and lacking the outer-membrane protein OprD. J Med Microbiol 2006;55(Pt 3):353-4. |
| 12. | Poirel L, Nordmann P. Rapidec Carba NP test for rapid detection of carbapenemase producers. J Clin Microbiol 2015;53:3003-8. |
| 13. | Köhler T, Michea-Hamzehpour M, Epp SF, Pechere JC. Carbapenem activities against Pseudomonas aeruginosa: Respective contributions of OprD and efflux systems. Antimicrob Agents Chemother 1999;43:424-7. |
[Figure 1]
[Table 1]
|
