Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 3675 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (953 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed2081    
    Printed40    
    Emailed0    
    PDF Downloaded91    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 34  |  Issue : 3  |  Page : 335-341
 

Association of interleukin-28B rs12979860 and rs8099917 polymorphisms with sustained viral response in hepatitis C virus genotype 1 and 3 infected patients from the Indian subcontinent


1 Department of Clinical Virology, Christian Medical College, Vellore, Tamil Nadu, India
2 Department of Biostatistics, Christian Medical College, Vellore, Tamil Nadu, India
3 Department of Hepatology, Christian Medical College, Vellore, Tamil Nadu, India

Date of Submission10-Jun-2015
Date of Acceptance23-May-2016
Date of Web Publication12-Aug-2016

Correspondence Address:
P Abraham
Department of Clinical Virology, Christian Medical College, Vellore, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.188329

Rights and Permissions

 ~ Abstract 

Background: Polymorphisms of the IL28B gene (rs12979860 and rs8099917) have been shown to impact treatment responses in hepatitis C virus (HCV) infected patients. The association of these polymorphisms with sustained viral response (SVR) has been studied in HCV genotype 3 infected patients in India, but not in genotype 1. Objectives: This study aimed to determine the association of IL28B gene polymorphisms and other host and viral factors with treatment response in patients with HCV genotype 1 and 3 infection. Materials and Methods: DNA from 42 HCV-infected patients on antiviral therapy was analysed for the IL28B polymorphisms using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Bidirectional sequencing was performed on a subset of samples for verification of PCR-RFLP results. Information on age, weight, height, diabetic status, pre-treatment viral load and alanine aminotransferase (ALT) levels was obtained from clinical records. The IL28B genotypes and the other factors were analysed for their association with SVR. Results: The frequency distribution of rs12979860 CC/CT/TT genotypes was found to be 66.7%, 26.2% and 7.1%, respectively. For rs8099917 genotype, the TT/GT/GG distribution was 73.8%, 21.4% and 4.8%, respectively. SVR was seen in 61.9% of cases (55.6% in genotype 1 and 62.5% in genotype 3). CC genotype at rs12979860 and TT genotype at rs8099917 were significantly higher in responders (P = 0.013 and 0.042, respectively). Lower baseline ALT and rapid viral response were also found to be associated with SVR. On logistic regression analysis, CC genotype at rs12979860 emerged as the most powerful predictor of treatment response. Conclusion: IL28B polymorphisms are strong predictors of SVR in patients from the Indian subcontinent infected with HCV genotype 3 and genotype 1.


Keywords: Hepatitis C virus, IL28B polymorphism, interferon, rapid viral response, sustained viral response


How to cite this article:
Ranjan P, Fletcher G J, Radhakrishnan M, Sivakumar J, Premkumar P S, Goel A, Zachariah U G, Abraham P. Association of interleukin-28B rs12979860 and rs8099917 polymorphisms with sustained viral response in hepatitis C virus genotype 1 and 3 infected patients from the Indian subcontinent. Indian J Med Microbiol 2016;34:335-41

How to cite this URL:
Ranjan P, Fletcher G J, Radhakrishnan M, Sivakumar J, Premkumar P S, Goel A, Zachariah U G, Abraham P. Association of interleukin-28B rs12979860 and rs8099917 polymorphisms with sustained viral response in hepatitis C virus genotype 1 and 3 infected patients from the Indian subcontinent. Indian J Med Microbiol [serial online] 2016 [cited 2019 Dec 15];34:335-41. Available from: http://www.ijmm.org/text.asp?2016/34/3/335/188329



 ~ Introduction Top


Hepatitis C virus (HCV) is an enveloped, single-stranded RNA virus belonging to the family Flaviviridae. It is a common cause of post-transfusion hepatitis in the resource-poor settings. HCV infection is a global health problem with a worldwide prevalence of around 2-3%, [1] with more than 185 million seropositive people worldwide. [2] India has over 10 million HCV seropositive individuals, the disease being largely spread by blood transfusion and unsafe injection practices. [3] Chronic hepatitis C shows a variable clinical outcome ranging from chronic hepatitis, liver cirrhosis, end-stage liver failure and occasionally hepatocellular carcinoma, thus necessitating treatment. Pegylated interferon (PEG-IFN) plus ribavirin (RBV) has been the conventional standard of care therapy for chronic hepatitis C, duration of treatment being governed by the infecting genotype, i.e. 48 weeks for genotypes 1, 4, 5 and 6 while 24 weeks for genotypes 2 and 3. [4] There is a huge geographic variation in the distribution and prevalence of HCV genotypes worldwide. The predominant genotype in the western hemisphere is genotype 1, whereas genotype 3 is the most common in the Indian subcontinent, followed by 1 and 4 in that order. [5] Sustained viral response (SVR) rates of 40-50% are seen with genotype 1 HCV, and up to 80% in genotypes 2 and 3 infections. [4]

Since treatment is expensive and often accompanied by several adverse effects, the significance of viral and host factors which impact on the severity of disease and response to treatment becomes immense. Age <40 years, female gender, East Asian and Caucasian ethnicity, lower body mass index, absence of diabetes mellitus, absence of steatosis on liver biopsy, liver fibrosis with a staging score ≤2 are established factors which predict a good response to therapy. [6]

Recently several genome-wide association studies have shown that single nucleotide polymorphisms (SNPs) within or adjacent to the IL 28B gene (rs12979860 and rs8099917) are strongly associated with response to PEG-IFN/RBV therapy in genotype 1 infections. [7],[8],[9] The IL28B gene located on chromosome 19 codes for interferon λ3 which via the JAK-STAT pathway induces antiviral and antiproliferative activity in many cell types and upregulates interferon-stimulated genes. [10] The role of these polymorphisms and their impact on response has been studied not only in hepatitis C but in a large number of other infectious and non-infectious diseases, i.e., herpes simplex virus, cytomegalovirus, human T-lymphotropic virus and HIV to name a few. [11] The genotypes at rs12979860 are CC, CT and TT, while those at rs8099917 are TT, TG and GG. Homozygosity of the C allele at rs12979860 and homozygosity of the T allele at rs8099917 has been shown to be associated with a better treatment response in chronic HCV infection. These polymorphisms show a marked differential racial distribution [7] explaining much of the observed differences in the response rates to treatment in different ethnicities. Its association with spontaneous clearance of HCV infection has been shown irrespective of the viral genotype. [12] The association with virological response has also been found in HCV genotype 4. [13] The association of IL28B polymorphisms with response to treatment in HCV genotype 2 and 3 infections have remained controversial. [14]

Data on IL28 polymorphism from India are sparse. Three studies have attempted to determine the association of these polymorphisms with treatment response in HCV genotype 3 infected persons from the country. [15],[16],[17] However, an association of these polymorphisms with genotype 1 has not been studied in Indian patients even though it is the second most common genotype circulating in India.

Objectives

This study aimed to determine the association of IL28B gene polymorphisms at rs12979860 and rs8099917 with treatment response in patients with chronic HCV genotype 1 and 3 infection. We also studied the correlation of other host factors such as age, gender, body mass index, diabetes and baseline alanine aminotransferase (ALT) levels with response to IFN-based treatment.


 ~ Materials and Methods Top


Study design and patients

This was a longitudinal study conducted at a Tertiary Care Hospital in South India between April 2013 and April 2015. The approval for the study was obtained from the Institutional Review Board and Ethics Committee. Patients ≥18 years of age, with HCV genotype 1 or 3 infection on treatment with IFN (standard/pegylated) and RBV were recruited after written informed consent. The exclusion criteria were immunosuppression, hepatitis B virus or HIV coinfection, pregnancy, tuberculosis and patients on dialysis. Relevant information about the patient, such as age, gender, weight, height, diabetic status and liver enzymes, was obtained from clinical records.

Hepatitis C virus RNA quantitation and genotyping

Eight to ten mL of blood was collected by venipuncture in vacutainer tubes containing dipotassium ethylene diamine tetra acetate (BD Biosciences). The tube was centrifuged at 2500 rpm for 10 min and the supernatant plasma was stored at −60°C until HCV viral load testing and HCV genotyping. Buffy coat from the same tube was pipetted out and layered with an aliquot of cell freezing solution to make up a volume of 200 μl and then stored at −60°C until testing for the interleukin (IL) 28B polymorphisms.

HCV RNA levels were determined using Abbott real time HCV polymerase chain reaction (PCR) assay (Abbott, Wiesbaden, Germany), according to the manufacturer's protocol. Viral load measurement was done at baseline before the initiation of IFN/RBV therapy and thereafter at specific time points of monitoring, i.e., rapid viral response (RVR) at week 4, early viral response (EVR) at week 12, end of treatment response at 24/48 weeks of treatment and SVR which was measured 6 months after completion of therapy.

Viral genotyping was done by sequencing of the NS5B region of the HCV genome. Nested real-time-PCR (RT-PCR) was performed, followed by bidirectional sequencing using ABI PRISM 310 genetic analyzer (Applied Biosystems, California, USA).

Interleukin-28B genotyping

Genomic DNA was extracted from the buffy coat using QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany) as per manufacturer's protocol. The extracted DNA was quantified spectrophotometrically using Take3, Gen5™, BioTek. The two polymorphisms were genotyped using PCR-restriction fragment length polymorphism (PCR-RFLP) using primers as per an earlier published study. [18] Primers for the amplification of rs12979860 locus were 5' GCGGAAGGAGCAGTTGCGCT 3' (forward) and 5'GGGGCTTTGCTGGGGGAGTG 3' (reverse), while those for rs8099917 locus were 5'CCCACTTCTGGAACAAATCGTCCC 3' (forward) and 5'TCTCCTCCCCAAGTCAGGCAACC 3' (reverse). 100-300 ng of the DNA extract was amplified with 10 pmol of the respective primers and HotStar Taq Master Mix (Qiagen, Hilden, Germany) with a final reaction volume of 25 μl. The cycling conditions were as follows initial denaturation at 95°C for 15 min, denaturation for 30 s at 95°C, annealing for 30 s at 60°C for rs12979860 and 56°C rs8099917, followed by extension at 72°C for 45 min. These steps were repeated for 40 cycles with final extension at 72°C for 7 min. For RFLP analysis, digestion of the amplicons was carried out using restriction endonucleases BstUI and BsrDI (New England Biolabs, UK) for rs12979860 and rs8099917, respectively. The digested products were electrophoresed on a 3% of agarose gel and the polymorphisms were identified [Figure 1].
Figure 1: Polymerase chain reaction-restriction fragment length polymorphism electrophoresis results for interleukin-28B polymorphisms Lane 1: Ladder (25-500 bp), Lanes 2-8: rs12979860, Lanes 9-15: rs8099917, Lanes 5 and 12: Negative control (the fragment sizes for rs12979860 genotypes are CC-196, 45 bp; CT-241, 196, 45 bp; TT-241 bp. The fragment sizes for rs8099917 genotypes are TT-552 bp; GT-552, 322, 230 bp; GG-322, 230 bp)

Click here to view


A representative set of samples (5 each for rs12979860 and rs8099917) were bidirectionally sequenced by Sanger sequencing for verification of RFLP results [Figure 2]a and b]. The primers used were the same as those for PCR-RFLP, except the reverse primer for rs12979860, which was as follows: 5' GTGCCTTCACGCTCCGAGCA 3'. [18]
Figure 2: (a) Chromatogram showing sequence of rs12979860 (C/T) of interleukin-28B gene on chromosome 19. Lanes 1-3 show CC, CT and TT host genotypes in that order. (b) Chromatogram showing sequence of rs8099917 (T/G) of an interleukin-28B gene on chromosome 19. Lanes 1-3 show TT, GT and GG host genotypes in that order

Click here to view


Statistical analysis

Continuous variables were reported as mean ± standard deviations or median. Categorical variables were expressed as frequencies and percentages. Then, the association between response and other covariates were assessed using Chi-square or Fisher's exact test, as appropriate. P ≤ 0.05 was used as criterion for statistical significance. For IL 28B genotypes, the deviation from Hardy-Weinberg equilibrium was assessed, and association with response was performed using Chi-square test. Logistic regression analysis was performed with IL 28 genotypes and baseline ALT as covariates. All data generated in the study were analysed using Stata Statistical Software: Release 11. College Station, TX: StataCorp LP.


 ~ Results Top


A total of 78 patients from different parts of the Indian subcontinent were recruited in the study. Of them 42 could be followed up till the time point of measurement of SVR, and were thus included in the analysis. The remaining patients were either lost to follow-up, discontinued treatment or were at different stages of monitoring. In the cohort of 42 patients analysed, the median age was 48 years, and 64.3% of cases were males. Nine patients (21.4%) were infected with HCV genotype 1, 32 (76.2%) with genotype 3 and 1 (2.4%) with genotype 4. Since the duration of IFN/RBV based treatment of genotype 4 is similar to that of genotype 1, a case of genotype 4 was included in the study. An overall treatment efficacy of 61.9% was seen. The response rates in genotype 3 and 1 infections were 62.5% and 55.6% respectively, but the observed difference was not statistically significant (P = 0.706). We did not find any difference in response rates in the group treated with PEG IFN and standard IFN (60.7% vs 64% respectively, P = 1.00).

Host genotype frequencies at the two loci were studied, and it was found that rs12979860 CC/CT/TT distribution was 66.7%, 26.2% and 7.1%, respectively. On the other hand, rs8099917 TT/TG/GG distribution was found to be 73.8%, 21.4% and 4.8%, respectively. The distributions of the two polymorphisms were in accordance with Hardy-Weinberg equilibrium.

When the distribution of these polymorphisms in responders and non-responders were compared, it was found that CC genotype at rs12979860 and the TT genotype at rs8099917 were significantly higher in the responders [P = 0.013 and 0.042 respectively, [Figure 3] and [Figure 4].
Figure 3: Distribution of the rs12979860 genotypes in responders and non-responders

Click here to view
Figure 4: Distribution of the rs8099917 genotypes in responders and non-responders

Click here to view


Other variables such as age, gender, body mass index, baseline ALT levels, diabetic state and pre-treatment viral load were studied for their impact on SVR. Of these variables baseline ALT ≤ 105 U/ml (3 × upper limit of normal) was found to be significantly associated with treatment response [Table 1].
Table 1: Association of various host and viral factors with sustained viral response


Click here to view


Another variable analysed for its association with SVR was RVR. Measurement of RVR was possible only in 21 patients. Among the 21 patients who could be sampled for RVR, 17 showed undetectable viral loads and 16 of these attained SVR. Interestingly, the remaining 4 patients who did not achieve RVR failed to achieve SVR in due course. Although RVR was found to be highly predictive of treatment response [P = 0.0008, [Table 1], we did not attempt a logistic regression analysis owing to the small numbers involved.

Using logistic regression we studied the association of the two polymorphisms with SVR after adjusting for ALT. CC genotype at rs12979860 emerged as the most powerful predictor of treatment response [Table 2].
Table 2: Association of the IL 28B polymorphisms with sustained viral response


Click here to view



 ~ Discussion Top


After the genome-wide association studies established the significance of rs12979860 and rs8099917 polymorphisms in response to HCV antiviral therapy, several studies replicated the association in HCV genotype 1 and 4 infections. However, the association with HCV genotype 2 and 3 infections has been less clear, with a large number of studies showing contrasting results. [19],[20],[21],[22] However, the largest meta-analysis by Jimιnez-Sousa et al. found significant association rs12979860 and rs8099917 polymorphisms with treatment response in genotypes 2 and 3 infected patients, but the strength of association was three-fold lower than that for genotypes 1 and 4. [14] It has been suggested that the inherently higher treatment response rates in these genotypes might attenuate the effect of SNPs, and this necessitates the study of larger sample sizes to find significant differences. [14],[23]

Genotype 3 is the most prevalent genotype in the Indian subcontinent, followed by 1. In 2012, Sivaprasad et al.[24] studied the distribution of genotype and allelic frequency of IL28B rs12979860 polymorphism in 220 healthy uninfected controls in Andhra Pradesh, India, and found that the frequency of CC genotype (59%) was significantly higher compared to CT (34.09%) and TT (6.81%). However, the association of these SNPs with treatment response was not looked into. Thereafter, three studies have attempted to find out the association of the SNP (s) in HCV genotype 3 patients. However, ours is the first attempt from the country to look at the impact of these polymorphisms in genotype 1 infected patient, in addition to genotype 3. Notably, genotype 1 has been found to be the predominant genotype infecting patients in Southern India. [25],[26] Since ours is a referral centre with patients coming from far-off places, the longer duration of treatment and thereby follow-up required to establish SVR with genotype 1 hindered us from having more genotype 1 patients in this study. [Table 3] summarizes and compares the findings of the available Indian studies. In keeping with the other studies from the country, we found CC genotype at rs12979860 to be highly predictive of SVR. The TT genotype at rs8099917 was significantly higher in responders when compared to non-responders.
Table 3: Comparative analysis of Indian studies on the association of interleukin - 28B polymorphisms with sustained viral response in hepatitis C virus infection


Click here to view


When we studied the impact of other viral and host factors on treatment response, we found RVR and baseline ALT levels to be significantly associated with SVR. While IL28B genotypes are identified as the strongest pre-treatment predictor of sustained viral clearance, RVR is known to be the key on-treatment response predictor. [27] We found a strong association between RVR and SVR, similar to what was seen in the other Indian studies. [15],[16],[17]

Management of chronic HCV infection is undergoing a paradigm change with the increasing use of direct-acting antivirals (DAAs). Studies involving triple therapy (IFN with telaprevir and boceprevir ± RBV) found association of the IL28B polymorphisms with SVR. [28] However, with the use of more potent second generation DAAs such as sofosbuvir, the significance of IL28B genotyping may diminish. As long as IFN continues to be used as the backbone of therapy, IL28B testing may have prognostic value. [29] Information from this study is still relevant especially for those difficult-to-treat patients where the new DAAs for HCV are not available or are unaffordable.

Our study is limited in terms of number of patients we could follow-up beyond the duration of treatment since this is a tertiary care centre, catering to patients from geographically distant parts of the Indian subcontinent. We could not, therefore, analyze the relative strength of association of the polymorphisms in genotype 3 and 1 infections owing to the small numbers. However, with regard to attainment of SVR, there was no difference between genotype 1 and genotype 3. It would be ideal to study the impact of these polymorphisms as well as other host and viral factors on a large cohort of patients.


 ~ Conclusion Top


Our study has proven and reiterated the association of IL28B polymorphisms with response to IFN based treatment. IL28B genotypes have been acknowledged as the strongest pre-treatment predictors of response. Until such time till we enter into an IFN free era, their prognostic significance is valuable, and more so in resource-limited settings where DAAs are still expensive or not yet available. Moreover, as the association of these polymorphisms and interferon λ with other viral infections and non-infectious inflammatory diseases are being increasingly recognised, their significance is very relevant.

Acknowledgements

This study was partly supported by FLUID research grant (IRB min no: 8202 dated 13.02.2013) and Special Fund, Department of Clinical Virology, Christian Medical College, Vellore. We acknowledge Dr. CE Eapen and Dr. KG Sajith for their clinical inputs, Mr. Anantharam Raghavendran, Ms. Janaki, Ms. Kalaivani Radhakrishnan and Ms. Unnati Singh for their help in patient recruitment and Dr. JP Muliyil and Ms. Grace Rebekah for initial statistical analysis.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 ~ References Top

1.
Lavanchy D. Evolving epidemiology of hepatitis C virus. Clin Microbiol Infect 2011;17:107-15.  Back to cited text no. 1
    
2.
Mohd Hanafiah K, Groeger J, Flaxman AD, Wiersma ST. Global epidemiology of hepatitis C virus infection: New estimates of age-specific antibody to HCV seroprevalence. Hepatology 2013;57:1333-42.  Back to cited text no. 2
    
3.
Abraham P. Viral hepatitis in India. Clin Lab Med 2012;32:159-74.  Back to cited text no. 3
    
4.
Ghany MG, Nelson DR, Strader DB, Thomas DL, Seeff LB; American Association for Study of Liver Diseases. An update on treatment of genotype 1 chronic hepatitis C virus infection: 2011 practice guideline by the American Association for the Study of Liver Diseases. Hepatology 2011;54:1433-44.  Back to cited text no. 4
    
5.
Christdas J, Sivakumar J, David J, Daniel HD, Raghuraman S, Abraham P. Genotypes of hepatitis C virus in the Indian sub-continent: A decade-long experience from a tertiary care hospital in South India. Indian J Med Microbiol 2013;31:349-53.  Back to cited text no. 5
[PUBMED]  Medknow Journal  
6.
Feld JJ, Hoofnagle JH. Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature 2005;436:967-72.  Back to cited text no. 6
    
7.
Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009;461:399-401.  Back to cited text no. 7
    
8.
Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, et al. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet 2009;41:1105-9.  Back to cited text no. 8
    
9.
Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Weltman M, Abate ML, et al. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet 2009;41:1100-4.  Back to cited text no. 9
    
10.
Bellanti F, Vendemiale G, Altomare E, Serviddio G. The impact of interferon lambda 3 gene polymorphism on natural course and treatment of hepatitis C. Clin Dev Immunol 2012;2012:849373.  Back to cited text no. 10
    
11.
Griffiths SJ, Dunnigan CM, Russell CD, Haas JG. The role of interferon-λ locus polymorphisms in hepatitis C and other infectious diseases. J Innate Immun 2015;7:231-42.  Back to cited text no. 11
    
12.
Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, O'Huigin C, et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 2009;461:798-801.  Back to cited text no. 12
    
13.
Asselah T, De Muynck S, Broët P, Masliah-Planchon J, Blanluet M, Bièche I, et al. IL28B polymorphism is associated with treatment response in patients with genotype 4 chronic hepatitis C. J Hepatol 2012;56:527-32.  Back to cited text no. 13
    
14.
Jiménez-Sousa MA, Fernández-Rodríguez A, Guzmán-Fulgencio M, García-Álvarez M, Resino S. Meta-analysis: Implications of interleukin-28B polymorphisms in spontaneous and treatment-related clearance for patients with hepatitis C. BMC Med 2013;11:6.  Back to cited text no. 14
    
15.
Gupta AC, Trehanpati N, Sukriti S, Hissar S, Midha V, Sood A, et al. Interleukin-28b CC genotype predicts early treatment response and CT/TT genotypes predicts non-response in patients infected with HCV genotype 3. J Med Virol 2014;86:707-12.  Back to cited text no. 15
    
16.
Firdaus R, Biswas A, Saha K, Mukherjee A, Chaudhuri S, Chandra A, et al. Impact of host IL28B rs12979860, rs8099917 in interferon responsiveness and advanced liver disease in chronic genotype 3 hepatitis C patients. PLoS One 2014;9:e99126.  Back to cited text no. 16
    
17.
Chinnaswamy S, Das K, Bairagya BB, Bhattacharyya C, Shalimar, Duseja A, et al. Association of IL28B single nucleotide polymorphism rs8099917 with response to treatment in genotype 3 HCV-infected patients from India. Trop Gastroenterol 2014;35:96-102.  Back to cited text no. 17
[PUBMED]    
18.
Sharafi H, Pouryasin A, Alavian SM, Behnava B, Keshvari M, Mehrnoush L, et al. Development and validation of a simple, rapid and inexpensive PCR-RFLP method for genotyping of common IL28B polymorphisms: A useful pharmacogenetic tool for prediction of hepatitis C treatment response. Hepat Mon 2012;12:190-5.  Back to cited text no. 18
    
19.
Mangia A, Thompson AJ, Santoro R, Piazzolla V, Tillmann HL, Patel K, et al. An IL28B polymorphism determines treatment response of hepatitis C virus genotype 2 or 3 patients who do not achieve a rapid virologic response. Gastroenterology 2010;139:821-7, 827.e1.  Back to cited text no. 19
    
20.
Sarrazin C, Susser S, Doehring A, Lange CM, Müller T, Schlecker C, et al. Importance of IL28B gene polymorphisms in hepatitis C virus genotype 2 and 3 infected patients. J Hepatol 2011;54:415-21.  Back to cited text no. 20
    
21.
Moghaddam A, Melum E, Reinton N, Ring-Larsen H, Verbaan H, Bjøro K, et al. IL28B genetic variation and treatment response in patients with hepatitis C virus genotype 3 infection. Hepatology 2011;53:746-54.  Back to cited text no. 21
    
22.
Scherzer TM, Hofer H, Staettermayer AF, Rutter K, Beinhardt S, Steindl-Munda P, et al. Early virologic response and IL28B polymorphisms in patients with chronic hepatitis C genotype 3 treated with peginterferon alfa-2a and ribavirin. J Hepatol 2011;54:866-71.  Back to cited text no. 22
    
23.
Mangia A, Mottola L, Santoro R. Interleukin 28B polymorphisms as predictor of response in hepatitis C virus genotype 2 and 3 infected patients. World J Gastroenterol 2013;19:8924-8.  Back to cited text no. 23
    
24.
Sivaprasad S, Rao PN, Gupta R, Ashwini K, Reddy DN. The distribution of genotype and allelic frequency of IL28B gene polymorphism in Andhra Pradesh, India. J Clin Exp Hepatol 2012;2:112-5.  Back to cited text no. 24
    
25.
Valliammai T, Thyagarajan SP, Zuckerman AJ, Harrison TJ. Diversity of genotypes of hepatitis C virus in southern India. J Gen Virol 1995;76(Pt 3):711-6.  Back to cited text no. 25
    
26.
Raghuraman S, Shaji RV, Sridharan G, Radhakrishnan S, Chandy G, Ramakrishna BS, et al. Distribution of the different genotypes of HCV among patients attending a tertiary care hospital in South India. J Clin Virol 2003;26:61-9.  Back to cited text no. 26
    
27.
Griffin SD, Beales LP, Clarke DS, Worsfold O, Evans SD, Jaeger J, et al. The p7 protein of hepatitis C virus forms an ion channel that is blocked by the antiviral drug, Amantadine. FEBS Lett 2003;535:34-8.  Back to cited text no. 27
    
28.
deLemos AS, Chung RT. Hepatitis C treatment: An incipient therapeutic revolution. Trends Mol Med 2014;20:315-21.  Back to cited text no. 28
    
29.
Jensen DM, Pol S. IL28B genetic polymorphism testing in the era of direct acting antivirals therapy for chronic hepatitis C: Ten years too late? Liver Int 2012;32 Suppl 1:74-8.  Back to cited text no. 29
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04