Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1479 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (470 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusions
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed1768    
    Printed29    
    Emailed1    
    PDF Downloaded124    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 34  |  Issue : 2  |  Page : 146-152
 

A recombinant plasmid of composite cysteine proteinase inhibitor/glyceraldehyde-3-phosphate dehydrogenase gene of periodic Brugia malayi functions on DNA immunity in the host


Department of Parasitology, Medical College, Nantong University, Nantong, Jiangsu 226001, China

Date of Submission19-Nov-2014
Date of Acceptance22-Jan-2016
Date of Web Publication14-Apr-2016

Correspondence Address:
Z Fang
Department of Parasitology, Medical College, Nantong University, Nantong, Jiangsu 226001
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.180279

Rights and Permissions

 ~ Abstract 

Objectives: Both cysteine proteinase inhibitors (CPIs) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) play important roles in the pathogenesis of parasites and their relationship with the hosts. We constructed a new eukaryotic recombinant expression plasmid pcDNA3.1(+)-BmCPI/BmGAPDH of periodic Brugia malayi for investigation of the DNA vaccine-elicited immune responses. Materials and Methods: We cloned a gene encoding the CPIs and GAPDH from periodic B. malayi into vector pcDNA3.1. The composited plasmid or the control was injected into the tibialis anterior muscle of the hind leg in BALB/c mice, respectively. The target genes were detected by reverse transcription-polymerase chain reaction in muscle tissues. The stimulation index (SI) of T-lymphocyte proliferation and the levels of interferon-gamma (INF-g) and interleukin-4 ( IL-4) in serum were detected by thiazolyl blue tetrazolium blue and enzyme-linked immunosorbent assays. Results: The pcDNA3.1(+)-BmCPI/BmGAPDH was amplified from muscle tissues of the mice after immunisation. The SI of the immunised group was significantly higher than that of the two control groups (P < 0.05). The levels of INF-g and IL-4 of pcDNA3.1(+)-BmCPI/BmGAPDH group were both higher than those of the two control groups (P < 0.05). The level of INF-g of pcDNA3.1(+)-BmCPI/BmGAPDH group was significantly higher than that of pcDNA3.1(+)-BmCPI/CpG group (P < 0.05). Conclusions: We conclude that the recombinant plasmid pcDNA3.1(+)-BmCPI/BmGAPDH could elicit specific humoural and cellular immune responses in mice.


Keywords: Composite gene, cysteine proteinase inhibitor, DNA immunisation, glyceraldehyde-3-phosphate dehydrogenase, periodic Brugia malayi


How to cite this article:
Fang Z, Xu Q, Wu J Q, Lu S J, Wang Y Y, Fang H. A recombinant plasmid of composite cysteine proteinase inhibitor/glyceraldehyde-3-phosphate dehydrogenase gene of periodic Brugia malayi functions on DNA immunity in the host. Indian J Med Microbiol 2016;34:146-52

How to cite this URL:
Fang Z, Xu Q, Wu J Q, Lu S J, Wang Y Y, Fang H. A recombinant plasmid of composite cysteine proteinase inhibitor/glyceraldehyde-3-phosphate dehydrogenase gene of periodic Brugia malayi functions on DNA immunity in the host. Indian J Med Microbiol [serial online] 2016 [cited 2018 Dec 10];34:146-52. Available from: http://www.ijmm.org/text.asp?2016/34/2/146/180279



 ~ Introduction Top


Lymphatic filariasis is currently found in approximately 80 countries. Over one billion people around the world are at risk of lymphatic filariasis infection, and more than 120 million are already infected, with more than 40 million incapacitated or disfigured by the disease. Countries where lymphatic filariasis is found are mostly in the tropical and sub-tropical regions of the world. Lymphatic filariasis is the etiologic agent of zoonosis of both humans and animals that is mainly distributed in east and South-East Asia. There are two types of lymphatic filariasis, periodic Brugia malayi and Wuchereria bancrofti and 1.39 millions of infected individuals are found in China. [1]

Filariasis, a kind of insect-borne disease, is a serious hazard to human health. Due to global warming, extensive existence of transmission vectors and an increasing population, filariasis has entered easily into China. It gives rise to resurgence through the mobility of the foreign population such as tourists and migrant workers. Therefore, the control of filariasis still needs to be strengthened. [2],[3],[4]

Filaria is a multicellular human parasite with a complex life cycle and antigenic molecules as well as a variety of immune escape mechanisms which formed during the long-term evolution with the hosts. Currently, global research on filarial vaccines is far behind other important medical parasites. It is an important step in vaccine development to get the best immune protective effects, through selecting effective and protective antigens and combining them organically to get composite or mixed multivalent vaccines. [5],[6]

Cysteine proteinase inhibitors (CPIs) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) have many kinds of physiological functions. They are also important dominant antigens and play important roles in existence and development of parasites as well as the relationship with the hosts. [1],[7],[8] In this study, we construct a recombinant expression plasmid containing composite gene BmCPI/BmGAPDH of the periodic B. malayi and investigate its cellular immune responses in mice.


 ~ Materials and Methods Top


Amplification of the target genes

The primers were designed using software Primer 5.0 according to the known sequences of GAPDH and CPI of the periodic B. malayi in GeneBank and were synthesised by Sangon, China. The primers were BmGAPDH sense: 5'- CCGGATCCACCATGATTAACATTGACTAT-3', BmGAPDH antisense: 5'- CCCTCGAGTTAGGTTGCTGT AGCCATAT-3', BmCPI sense: 5'- CC GCTAGCAACGATG TCAATAAAAGA AG-3', BmCPI antisense: 5'- CCGGA TCCCTATGCACCAAT TAAAAC-3'. Total RNA was extracted using a Trizol reagent (Promega, USA) according to the manufacturer's instructions. The absorbance of total RNA was determined (values of A 260 and A 280 ). The quality of RNA was determined by formaldehyde-agarose gel electrophoresis. The target gene sequences were amplified by reverse transcription-polymerase chain reaction (RT-PCR) and the PCR products were identified by 1% agarose gel electrophoresis.

Construction of vectors expressing the target genes

The above-mentioned products of RT-PCR were separated in 1% agarose gel, and the target bands were purified using a DNA gel extraction kit (Sangon Biotech, China). The target genes were TA-cloned into a pGEM-T Easy vector (Promega, USA). And then the constructs were transformed to DH5α  Escherichia More Details coli competent cells. The positive clones were selected by blue-white selection and then amplified. The plasmid DNA was isolated by an extraction kit and detected by PCR. The presence of the inserts was further confirmed by enzyme cleavage identification with BamH I/Xho I, and Nhe I/BamH I, respectively. The positive recombinant plasmids pGEM-T/BmGAPDH and pGEM-T/BmCPI sequenced by Sangon, China.

Construction and identification of the recombinant expression plasmid pcDNA3.1(+)-BmCPI/BmGAPDH containing the composite genes

The recombinant plasmid pGEM-T/BmGAPDH was digested with BamH I and Xho I. The recombinant plasmid pGEM-T/BmCPI with Nhe I and BamH I, and the eukaryotic expression vector pcDNA3.1(+) (Institution of Prevention and Control on Parasitic Disease of Jiangsu Province) with Xho I and Nhe I. The fragments of GAPDH, CPI and pcDNA3.1(+) was extracted after low melting point agarose electrophoresis. The ligation reaction contained a ratio of GAPDH: CPI: pcDNA3.1(+) as 4:4:1 with a volume of 25 μl. After transforming the ligation products into DH5α E. coli competent cells, expand the selected bacterial colonies. Purificate these plasmids, and digest them with BamH I/Xho I, Nhe I/BamH I, and Xho I/Nhe I (Takara, Japan), respectively. 1.0% low melting point agarose electrophoresis was taken to verify the presence and size of the insert fragments, with plasmid pcDNA3.1(+) as the control.

Purification and identification of the eukaryotic expression plasmid

The plasmid DNA pcDNA3.1(+)/BmCPI/BmGAPDH was isolated using a plasmid miniprep kit (Promega, USA) according to the manufacturer's procedures. The values of the absorbance of the extracted recombinant plasmid were measured by ultraviolet spectrophotometer at the wavelength of 260 nm and 280 nm. The concentration and purity of the plasmid was determined by the values of A 260 and A 280 . Then, dilute the concentration to 1 mg/ml finally. Store it at −20°C.

Preparation of immunologic adjuvant CpG oligodeoxynucleotide

CpG oligodeoxynucleotide (CpG ODN) is the most representative among a new type of immunologic adjuvant. [9] The sequence of CpG ODN 1826 was 5′-TCCATGACGTTCCTGACGTT-3′, which was synthesised by invitrogen. All phosphoric acid in the skeleton was phosphorothioate to enhance nuclease resistance. CpG ODN 1826 was diluted to a concentration of 1 mg/ml solution by normal saline.

Strains and experimental animals

The periodic B. malayis were got from positive mongolian gerbil models provided by Dalian Medical University, and were stored in normal saline under −70°C after being isolated. The experimental animals were specific pathogen free BALB/c mice, female, 6-7 week old, weighing 20 ± 2 g, provided by Experimental Animal Centre at Nantong University. The experiments were carried out in accordance with the guidelines issued by the Ethical Committee of Nantong University.

Immunisation of animals

The BALB/c mice were assigned at random into four groups, with 12 mice in each group. The method and dose of injections are as follows, control group A (phosphate-buffered saline [PBS] group) was treated with PBS at 100 μg per mouse; control group B (pcDNA3.1[+]/CpG group) was treated with pcDNA3.1(+) at 100 μg per mouse and CpG at 30 μg per mouse; group C (pcDNA3.1[+]-BmCPI/CpG group) was treated with pcDNA3.1-BmCPI at 100 μg per mouse and CpG at 30 μg per mouse; group D (pcDNA3.1(+)-BmCPI/BmGAPDH/CpG group) was treated with pcDNA3.1(+)-BmCPI/BmGAPDH at 100 μg per mouse and CpG at 30 μg per mouse. Mice were injected into tibialis anterior muscle of the hind leg for 3 times at a 2-week interval each time. The concentration of Bupivacaine Hydrochloride Injection was diluted to 0.5 mg/ml. Twenty-four hours before each injection, the vaccination site was pretreated with 50 μl bupivacaine hydrochloride injection.

Determination of the target genes expressing in vivo by reverse transcription-polymerase chain reaction

Muscles of the vaccination site of mice were harvested at 4 weeks after the last injection. The total RNA was extracted using a trizol reagent. Then the first strand of DNA was reversely transcribed using oligo-dT as a primer and mRNA of total RNA as a template. Then, the fragments of the target gene were amplified and determined by agarose gel electrophoresis.

Detection of specific antibodies using enzyme-linked immunosorbent assay

Blood samples were taken 3 times from each inoculated mouse: Immediately before the first inoculation, and 4 and 6 weeks after the inoculation, respectively. Sera were separated from these samples and stored at −80°C until use. For a standard enzyme-linked immunosorbent assay (ELISA), a solution containing 40 μg of the purified pcDNA3.1-BmCPI/BmGAPDH expression protein in 0.1 M bicarbonate buffer (pH 9.6) was pipetted into the wells of a polystyrene microtitre plate, and incubated at 4°C for 24 h. Following incubation with a test serum for at 37°C 1 h, the wells were washed 3 times and filled with a goat anti-mouse-IgG-horseradish-peroxidase conjugate. Specific antibodies were measured by ELISA.

Specific T-lymphocytes proliferation assay by thiazolyl blue tetrazolium blue

Four mice per group were anatomised at 4 and 6 weeks after the last injection. The spleens were made in to cell suspension. Concentration of cells was adjusted to 2 × 10 6 cells/ml after being dyed by trypan-blue and number counted to ensure that the living cells was more than 95%. T-lymphocyte proliferation of each group was determined from stimulation index (SI), which was calculated as the mean of A 570 of cultures containing concanavalin A divided by that of culture without concanavalin A.

Detection of serum cytokines interleukin-4 and interferon-gamma

Blood was taken from eye sockets of mice to collect blood serum at 2, 4 and 6 weeks after the last injection. Samples and relevant reagents were placed at room temperature for 20 min. Samples were diluted at a ratio of 1:2 and were operated according to the manufacturer's protocols. The contents (pg/ml) of interleukin-4 (IL-4) and interferon-gamma (INF-g) (Jingmei Bio-engineering Co., Ltd., China) were determined by the value of OD 450 using microplate reader.

Statistical analysis

Experimental data were expressed as mean ± standard deviation. A one-way analysis of variance was used, followed by Dunnet's test for multiple comparison. P < 0.05 was considered statistically significant.


 ~ Results Top


Construction and identification of the eukaryotic expression plasmid pcDNA3.1(+)-BmCPI and pcDNA3.1(+)-BmGAPDH

The amplified target genes were TA-cloned into pGEM-T easy vector. The specific fragments of 621 bp and 877 bp were amplified by PCR, respectively. Through selection of the positive clones, digestion, extraction of the target fragments and ligation of the fragments with vector pcDNA3.1(+), the eukaryotic expression plasmid was constructed successfully. The recombinant plasmid pcDNA3.1(+)-BmCPI and pcDNA3.1(+)-BmGAPDH was digested by restriction enzymes BamH I/Nhe I, and BamH I/Xho I, respectively, and the length of the digested fragments were in accordance with the forecast [Figure 1] and [Figure 2].
Figure 1: Enzyme digestion identification of the recombinant pcDNA3.1(+)-BmCPI plasmid by agarose gel electrophoresis. The specific fragments of 621 bp was obtained, which corresponded with the predicted position of the gene of interest. M: DNA marker, Lane 1: Polymerase chain reaction product of BmCPI gene, Lane 2: pcDNA3.1(+)-BmCPI plasmid digested with Nhe I and BamH I endonucleases, Lane 3: pcDNA3.1(+) plasmid

Click here to view
Figure 2: Enzyme digestion identification of recombinant pcDNA3.1(+)-BmGAPDH plasmid by agarose gel electrophoresis. The specific fragments of 877 bp was obtained, which corresponded with the predicted position of the gene of interest. M: DNA marker, Lane 1: plasmid pcDNA3.1(+)-BmGAPDH digested with BamH I and Xho I endonucleases, Lane 2: pcDNA3.1(+) plasmid, Lane 3: Polymerase chain reaction product of pcDNA3.1(+)-BmGAPDH, Lane 4: Polymerase chain reaction product of BmGAPDH gene

Click here to view


Construction and identification of eukaryotic expression vector pcDNA3.1(+)-BmCPI/BmGAPDH containing composite gene

The specific fragments of 621 bp and 877 bp were amplified by PCR using pcDNA3.1(+)/BmCPI/BmGAPDH as the template. PcDNA3.1(+)-BmCPI/BmGAPDH was digested by restriction enzymes BamH I/Nhe I, and BamH I/Xho I, respectively. The length of the digested fragments was in accordance with the forecast [Figure 3].
Figure 3: pcDNA3.1(+)-BmCPI/BmGAPDH was digested by restriction enzymes BamH I/Nhe I, and BamH I/Xho I, respectively. The length of the digested fragments was in accordance with the forecast. The specific fragments of 621 bp and 877 bp were amplified by polymerase chain reaction. M: DNA marker, Lane 1: pcDNA3.1(+)-BmCPI/BmGAPDH plasmid, Lane 2: plasmid pcDNA3.1(+)-BmCPI/BmGAPDH digested with Nhe I and BamH I endonucleases, Lane 3: plasmid pcDNA3.1(+)-BmCPI/BmGAPDH digested by BamH I and Xho I endonucleases, Lane 4: pcDNA3.1(+) plasmid

Click here to view


Determination of target genes expressing in mice

The result showed that the amplified specific electrophoretic bands were clear, and the length of RT-PCR product was in accordance with that of PCR product using cDNA as the template. It indicated that the DNA vaccine containing target genes of periodic B. malayi was able to be expressed in the muscle of mice [Figure 4].
Figure 4: Bm CPI and BmGAPDH gene detection in muscle tissue of mice vaccinated with recombinant plasmid by polymerase chain reaction. The amplified specific electrophoretic bands were clear, and the length of reverse transcription-polymerase chain reaction product was in accordance with that of polymerase chain reaction product using cDNA as the template. M: DNA marker, Lane 1: Blank control, Lane 2: Polymerase chain reaction product with BmGAPDH cDNA as a template, Lane 3: Reverse transcription-polymerase chain reaction products of BmGAPDH gene, Lane 4: Polymerase chain reaction product with BmCPI cDNA as a template, Lane 5: Reverse transcription-polymerase chain reaction products of BmCPI gene

Click here to view


Detection of serum antibody titre in vaccinated mice

When pcDNA3.1(+)-BmCPI/BmGAPDH protein was checked by western blot analysis, one specific band at 54 kDa was revealed (data not shown). The protein preparation was therefore assumed to be quite pure and be the target antigen. In the standard ELISA, the postchallenge sera from the mice immunised with the DNA vaccine had specific antibody titres of 1:1600-1:6400, and the highest titre was observed in the mice that were inoculated using pcDNA3.1(+)-BmCPI/BmGAPDH/CpG later at 6 weeks [Table 1].
Table 1: Serum antibody titre in vaccinated mice detected by enzyme - linked immunosorbent assay


Click here to view


Lymphocyte proliferation assay

The spleens were obtained/extracted at 4 and 6 weeks after the last injection, stimulated by ConA. Lymphocyte proliferation was determined by SI. There was no staistical significance between PBS control group and the empty plasmid control group (P > 0.05). SI of the immune group of pcDNA3.1(+)-BmCPI/CpG and pcDNA3.1(+)-BmCPI/BmGAPDH/CpG increased gradually along with the immune time prolonged. The difference between immune groups and control groups was statistically significant (P < 0.05). Especially, SI of pcDNA3.1(+)-BmCPI/BmGAPDH/CpG group rose more than other groups after 6 weeks [Table 2].
Table 2: Lymphopoiesis test in mice during immunization (thiazolyl blue tetrazolium blue method, A570 value)


Click here to view


Detection of cytokine interferon-gamma in serum

The cytokine (CK) INF-g in serum of pcDNA3.1(+)-BmCPI/CpG group and pcDNA3.1(+)-BmCPI/BmGAPDH/CpG group is significantly higher than those of the empty plasmid control group and PBS control group (P < 0.05). INF-g of pcDNA3.1(+)-BmCPI/BmGAPDH/CpG group 4 weeks later rose more than 2 weeks later (P < 0.05). IFN-g of pcDNA3.1(+)-BmCPI/BmGAPDH/CpG group was significantly higher than that of pcDNA3.1(+)-BmCPI/CpG group (P < 0.05). There was no significant difference of INF-g between empty plasmid control group and PBS control group (P > 0.05) [Table 3].
Table 3: IFN -γ level in serum of mice during immunisation (pg/ml)


Click here to view


Detection of cytokine interleukin-4 in serum

There was no statistical significance of IL-4 in serum between immune groups of pcDNA3.1(+)-BmCPI/BmGAPDH/CpG and two control groups of PBS group and pcDNA3.1(+)/CpG group 2 weeks after injection (P > 0.05). IL-4 in serum of immune groups of pcDNA3.1(+)-BmCPI/CpG and pcDNA3.1(+)-BmCPI/BmGAPDH/CpG were significantly higher than that of two control groups 4 weeks after injection (P < 0.05) and 6 weeks after injection (P < 0.05). There was no significant difference of IL-4 between the immune groups (P > 0.05) and there was no significant difference of IL-4 between the control groups (P > 0.05) [Table 4].
Table 4: IL - 4 level in serum of mice during immunisation (pg/ml)


Click here to view



 ~ Discussion Top


Active immunity with vaccines is one of the effective methods to prevent infectious diseases. Filaria is a multicellular human parasite with two developmental stages including inside-mosquito stage and inside-human-body stage. Monovalent vaccines can hardly induce sufficiently effective immunological protection because of filaria's complex life cycle, antigenic molecules and multiple immune escape mechanisms during a long-term evolution with hosts. CPI of parasites, an immunomodulator, has the capacity to regulate the generation of certain CK, and induce anti-inflammatory responses. It can make the host, transform from protective Th1 immune response to non-protective Th2 immune response. GAPDH, a physiological and metabolic enzyme widely existing in prokaryotes and eukaryotes, plays an important role in glycometabolism. Both GAPDH and CPI might become important target molecules of vaccines and drugs, which own good application prospects in anti-infection of parasites because they have many kinds of physiological functions during filaria's development process. [10],[11],[12] In this study, taking epidemic periodic B. malayi in our country as a research object, we constructed a recombinant expression plasmid containing composite genes of BmCPI/BmGAPDH and then detected the cellular immune responses after injection into the mice to lay a foundation for multivalent anti-filaria genetic engineering vaccines.

The fundamental principle of the genetic vaccine is to insert a gene coding an exogenous antigen into a eukaryotic expression vector, and then to inject the plasmid directly into the human bodies or animal bodies to make it express the antigenic protein; which can induce immune response in host cells. The advantages of DNA vaccines are easy to operate, stable, and low cost; having a good immune effect, and inducing strong immune responses; being able to stay in a host for a long time and induce lasting immune responses; and being able to be applied to prevent frequently variant antigens or antigens with many serotypes. We chose a traditional intramuscular injection method to immunise mice. The time for taking in exogenous genes to express protein in muscle cells is longer than that for other cells. Moreover, the advantages of muscle tissues are safety, great bulk and large inoculation capacity. Twenty-four hours before injection, we pretreated the injection site with an anaesthetic Bupivacaine Hydrochloride Injection to improve the uptake of DNA by muscle. Bands whose length was in accordance with the target genes' were obtained after extraction of total RNA from the injection site and detection by RT-PCR, which indicated that this eukaryotic recombinant DNA vaccine could be expressed in eukaryotic cells. In this experiment, SI of splenic lymphocyte from the mice in immune groups increased obviously after stimulation by ConA in vitro, and the difference of SI was significant between immune groups and the control ones. It indicated that this DNA vaccine could induce cellular immune responses in mice.

The cells are divided into two subsets Th1 and Th2, according to types of CK generating during activated processes. Th1 cells secrete IFN-g but not IL-4, and activate main cellular immunities. Th2 cells secrete IL-4 and IL-10 but not IFN-g and activate the synthesis of antibodies. These two types of cells can restrain activities with each other by the secreted CK to regulate immune responses. The DNA vaccine mainly induces Th1 cellular immune response. In this experiment, the significant difference of IFN-g in serum of the mice between pcDNA3.1(+)-BmCPI/BmGAPDH group and control ones started at 2 weeks after injections while the statistically significant differences of IL-4 started at 4 weeks, and the statistically significant differences of IL-4 in serum of the mice between pcDNA3.1(+)-BmCPI/BmGAPDH group and pcDNA3.1(+)-BmCPI group at 6 weeks which indicated that cellular immune response induced by the DNA vaccine containing this composite gene was a major type of Th1. CpG ODN as a new type of immunoadjuvant can activate higher immune system in animal; activate immunocompetent cells such as B-lymphocyte, macrophagocyte (M), dendritic cell and natural killer cell induce a lot of various CK such as IL-1, IL-6, IL-12, IL-18, tumor necrosis factors -α, IFN-α and IFN-g and enhance specific and nonspecific immune responses when injected together with the vaccine. [13],[14]

Another unique advantage of DNA vaccine is that it can provide possibilities for co-immunisation, that is to say we can construct a plasmid containing different antigenic genes or combine several plasmids containing different antigenic genes to prepare multi-functional vaccines: Composite vaccine or multivalent vaccine to get the same immune effect with several times of different immunisations at one time. [15] In this study, we found SI of splenic lymphocyte from the mice in pcDNA3.1(+)-BmCPI/BmGAPDH/CpG group increased obviously 6 weeks after injection, and its increased amplitude was higher than pcDNA3.1(+)-BmCPI/CpG group. IFN-g in serum from the mice in the two immune groups increased obviously all the time, especially, IFN-g of pcDNA3.1(+)-BmCPI/BmGAPDH/CpG increased more significantly and had a significant difference with IFN-g of pcDNA3.1(+)-BmCPI/CpG group. In this experiment, we performed a preliminary study on this field. We will make a further study on composite DNA vaccine for periodic B. malayi.


 ~ Conclusions Top


We conclude that the recombinant plasmid pcDNA3.1(+) BmCPI/BmGAPDH could elicit specific humoural and cellular immune responses in mice.

Acknowledgements

This work was supported by the College Students Practice Innovation Program of Jiangsu Province (201413993001Y) and the Graduate Students Innovation Projects of Nantong University (YKC14049).

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 ~ References Top

1.
Fang Z, Tong H, Zhang S, Fang H, Lu S, Xu B. Construction of a recombinant plasmid harbouring the glyceraldenyde-3-phosphate dehydrogenase gene of periodic Brugia malayi and observation on DNA immunity. Indian J Med Microbiol 2012;30:193-7.  Back to cited text no. 1
[PUBMED]  Medknow Journal  
2.
Zhang XC, Huang SY, Deng ZH, Ou ZY, Wu WP, Luo XC, et al. Follow-up survey on the imported cases of lymphatic filariasis in Guangdong Province. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 2008;26:409-11.  Back to cited text no. 2
    
3.
Fu B, Li GL, Hu YX, Cao XC, Sun CH, Li HJ. Investigation on the impact of imported cases on filariasis elimination program in Shandong Province. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 2003;21:96-8.  Back to cited text no. 3
    
4.
Xie DF, Fang Z, Tong HY, Xu BS, Huang WQ, Fang H, et al. Cloning, sequencing of G3PD gene from Brugia malayi and prediction of B cell epitopes in its amino acid sequence. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 2009;27:226-8.  Back to cited text no. 4
    
5.
Bunnell BA, Morgan RA. Gene therapy for infectious diseases. Clin Microbiol Rev 1998;11:42-56.  Back to cited text no. 5
    
6.
Morris CP, Evans H, Larsen SE, Mitre E. A comprehensive, model-based review of vaccine and repeat infection trials for filariasis. Clin Microbiol Rev 2013;26:381-421.  Back to cited text no. 6
    
7.
Hartmann S, Kyewski B, Sonnenburg B, Lucius R. A filarial cysteine protease inhibitor down-regulates T cell proliferation and enhances interleukin-10 production. Eur J Immunol 1997;27:2253-60.  Back to cited text no. 7
    
8.
Daubenberger CA, Pöltl-Frank F, Jiang G, Lipp J, Certa U, Pluschke G. Identification and recombinant expression of glyceraldehyde-3-phosphate dehydrogenase of Plasmodium falciparum. Gene 2000;246:255-64.  Back to cited text no. 8
    
9.
Zhao F, Liu S, Zhang X, Yu J, Zeng T, Gu W, et al. CpG adjuvant enhances the mucosal immunogenicity and efficacy of a Treponema pallidum DNA vaccine in rabbits. Hum Vaccin Immunother 2013;9:753-60.  Back to cited text no. 9
    
10.
Yang HW, Yong TS, Lee JH, Im KI, Park SJ. Characterization of two glyceraldehyde 3-phosphate dehydrogenase genes in Giardia lamblia. Parasitol Res 2002;88:646-50.  Back to cited text no. 10
    
11.
Akinyi S, Gaona J, Meyer EV, Barnwell JW, Galinski MR, Corredor V. Phylogenetic and structural information on glyceraldehyde-3-phosphate dehydrogenase (G3PDH) in Plasmodium provides functional insights. Infect Genet Evol 2008;8:205-12.  Back to cited text no. 11
    
12.
Magister S, Kos J. Cystatins in immune system. J Cancer 2013;4:45-56.  Back to cited text no. 12
    
13.
Klinman DM. Adjuvant activity of CpG oligodeoxynucleotides. Int Rev Immunol 2006;25:135-54.  Back to cited text no. 13
    
14.
Somroop S, Tongtawe P, Chaisri U, Tapchaisri P, Chongsa-nguan M, Srimanote P, et al. Traffic of antibody-secreting cells after immunization with a liposome-associated, CpG-ODN-adjuvanted oral cholera vaccine. Asian Pac J Allergy Immunol 2006;24:229-38.  Back to cited text no. 14
    
15.
Gurunathan S, Wu CY, Freidag BL, Seder RA. DNA vaccines: A key for inducing long-term cellular immunity. Curr Opin Immunol 2000;12:442-7.  Back to cited text no. 15
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04