Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1674 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (516 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed2337    
    Printed59    
    Emailed1    
    PDF Downloaded251    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
BRIEF COMMUNICATION
Year : 2015  |  Volume : 33  |  Issue : 5  |  Page : 129-133
 

Molecular epidemiology of methicillin resistant staphylococcus aureus colonizing the anterior Nares of school children of Udupi Taluk


1 Department of Microbiology, Melaka Manipal Medical College, Manipal, India
2 Research Assistant , Manipal School of Life Sciences, Manipal, Karnataka, India

Date of Submission30-Nov-2013
Date of Acceptance06-Sep-2014
Date of Web Publication6-Feb-2015

Correspondence Address:
S Govindan
Department of Microbiology, Melaka Manipal Medical College, Manipal
India
Login to access the Email id

Source of Support: Part of this work was funded by Department of Biotechnology, Govt. of India, Conflict of Interest: None


DOI: 10.4103/0255-0857.150919

Rights and Permissions

 ~ Abstract 

Context: Community associated methicillin resistant Staphylococcus aureus (CA-MRSA) cause serious skin and soft tissue infections including necrotizing fasciitis and necrotizing pneumonia. Production of Panton Valentine Leucocidine (PVL) toxin is implicated in its enhanced virulence. A variant of epidemic MRSA-15 (EMRSA-15) which produces PVL toxin has been isolated and characterized by pulsed-field gel electrophoresis (PFGE) method from the Indian population both in hospital and community settings. Aims: Identify the epidemiological type of MRSA colonizing the anterior nares of school children in Udupi taluk. Settings and Design: The study population included children of the age group of 5-16 years belonging to the Udupi taluk of Karnataka, India. A total of 1503 children were screened for MRSA colonization during July 2009 to December 2010. Materials and Methods: PVL assay, Staphylococcal Cassette Chromosome (SCC) mec typing and PFGE typing were carried out with all the MRSA isolates. Statistical Analysis Used: Frequency distribution of different variables was assessed by SPSS. Results: Among the 1.1% of MRSA, 58.8% (10/17) of isolates were positive for pvl and 41.7% (7/17) were identified as SCC mec type IV. PFGE patterns of all the strains were identical with Indian variant EMRSA-15; however they were different from classical EMRSA-15 in 3-4 bands. Conclusions: The Indian variant EMRSA-15 gains much epidemiological relevance owing to the acquisition of pvl gene. In spite of low prevalence of nasal colonization of MRSA, emergence of the virulent Indian variant EMRSA-15 in our community is a worrisome fact to be reckoned with.


Keywords: Community associated methicillin resistant Staphylococcus aureus, Epidemic methicillin resistant SA-15, Panton valentine leucocidine, staphylococcal cassette chromosome mec


How to cite this article:
Govindan S, Maroli A S, Ciraj A M, Bairy I. Molecular epidemiology of methicillin resistant staphylococcus aureus colonizing the anterior Nares of school children of Udupi Taluk. Indian J Med Microbiol 2015;33, Suppl S1:129-33

How to cite this URL:
Govindan S, Maroli A S, Ciraj A M, Bairy I. Molecular epidemiology of methicillin resistant staphylococcus aureus colonizing the anterior Nares of school children of Udupi Taluk. Indian J Med Microbiol [serial online] 2015 [cited 2019 Aug 17];33, Suppl S1:129-33. Available from: http://www.ijmm.org/text.asp?2015/33/5/129/150919



 ~ Introduction Top


Staphylococcus aureus (SA) is an important agent causing variety of skin and soft tissue infections in human beings. If the strain is methicillin resistant, the complications and consequences are much higher. Methicillin resistant SA (MRSA) has got special importance because they are resistant to all types of betalactam antibiotics. In the past decade the incidence of both community associated (CA) and hospital associated (HA) MRSA infections have increased. [1],[2] Emergence of CA-MRSA strains susceptible to non-betalactam antibiotics was a reckonable observation when noticed in the last decade of the 20 th century. The importance of such strains was underscored by the 1999 report detailing the deaths of four US children with invasive MRSA infection while, none of them had identifiable MRSA risk factors. [3] Existence of such strains have been noticed in adult Indian population as well at least by some of the researchers. [4] Pulsed field gel electrophoresis (PFGE) typing of the isolates confirmed that these community strains were distinct from nosocomial strains isolated from patients in local hospitals.

CA-MRSA strains display enhanced virulence, spreading more rapidly and causing illness much more severe than traditional HA-MRSA. They can affect vital organs and lead to widespread infection like, toxic shock syndrome, necrotizing fasciitis and necrotizing pneumonia leading to high rates of morbidity and mortality. [5] This is thought to be due to toxins carried by CA-MRSA strains, such as Panton Valentine leucocidine (PVL). It is a bicomponent exotoxin released from some strains of SA encoded by pvl gene. It destroys white blood cells (WBC) and it is an important virulence factor. The role of PVL in necrotizing pneumonia has been proved by a murine model of acute primary pneumonia. [6]

During 1990s epidemic methicillin resistant SA-15 (EMRSA-15) emerged in the hospital settings as per the reports from UK. Later, this classical EMRSA-15 has been isolated from community settings as well and characterized as staphylococcal cassette chromosome mec (SCC mec) type IV community associated MRSA (CA-MRSA). SCC is a unique genomic island that harbours mecA gene which is responsible for methicillin resistance in SA. [7] Majority of the CA-MRSA causing infections in Indian subcontinent have been identified as SCC mec IV. [8],[9],[10] A variant of EMRSA-15 which produces PVL toxin has been isolated and characterized by PFGE method from the Indian population both in hospital and community settings. [9],[11] In addition to the methods such as SCC mec typing and PVL assay, the highly discriminating PFGE technique was also employed to ascertain the chances of the Indian variant strain of EMRSA-15 making its presence in the region under study. [9],[11]

Epidemiological typing of the infectious agent can be considered as one of the important weapons in the armamentarium of the infection control specialists as this pin points the epidemiological clone of MRSA prevalent in the community. Unfortunately there is not much published data available about the epidemiological type of MRSA colonizing the children from this part of the country. So the objective of this current study was to characterize the MRSA strains colonizing the anterior nares of school children from Udupi taluk, Karnataka, India by PVL assay, SCC mec typing and PFGE typing.


 ~ Materials and Methods Top


A community based cross sectional study was conducted in selected schools of Udupi taluk, Karnataka state, INDIA. Nasal swabs from 1 cm inside the anterior nares of both nostrils from 1503 school children of the age between 5-16 years were collected using sterile cotton swabs (Hi Media, India) during July 2009 to December 2010. Institutional ethics committee clearance was obtained prior to the study. Since the subjects were minors, informed consent was taken from their parents/guardians.

Each swab was inoculated in to blood agar (BA) and mannitol salt agar (MSA) and incubated at 37 o C aerobically. Confirmed colonies of SA were inoculated onto Muller Hinton Agar (MHA) containing 4% sodium chloride and 6 μg/ml of oxacillin. Growth of one or more colonies of SA in this medium was considered as MRSA. During antibiotic susceptibility testing, susceptibility to 30 μg cefoxitin was also tested. A zone diameter of ≤19 mm is considered as resistance and confirmed as MRSA. [12]

All the MRSA isolates were initially characterized based on their antibiotic susceptibility pattern and urease production and were typed by the presence of pvl gene, SCC mec typing and PFGE patterns. PVL assay was carried out by a polymerase chain reaction (PCR) based method as described by Lina et al. [13] Genes responsible for PVL production (pvl) were determined using Luk F PV and Luk S PV primers. The primers used were 5' ATCATTAGGTAAAATGTCTGGACATGATCCA 3' and 5' GCATCAASTGTATTGGA 3' respectively. DNA was extracted from each strain of MRSA by phenol chloroform extraction method and the expected amplified product size was 433 bp. SCC mec typing was performed by a multiplex PCR method published by Milheirico et al. [14] The common CA-MRSA types like SCC mec type IV and V were only included in the assay. Total of 5 primers were included in the initial PCR which were to amplify the genes necessary to identify and differentiate SCC mec type IV and V. All the SCC mec types IV were reconfirmed for presence of insertion sequence IS 1272 by a different single locus PCR. Details of all the primers used in SCC mec typing are shown in [Table 1]. Selected strains were subjected to PFGE after Sma I restriction digestion according to the protocol developed and reported by Nadig et al. [9] The reference strains such as ATCC 43300 (PVL negative MRSA), WCH 1000 (SCC mec type V strain), USA 300 (SCC mec type IV (PVL positive)), NCTC 8325 (HA-MRSA) and NCTC 13142 (Classical EMRSA-15) were included in the study. Frequency distribution of different types of MRSA like; PVL positive, SCC mec IV and V were analyzed using SPSS 16.0.
Table 1: Details of the primers used in PCR for SCC mec typing

Click here to view



 ~ Results Top


SA was isolated from 441 children out of 1503 subjects screened and the prevalence of SA colonization was estimated as 29.3% (95% CI 27, 31.6). The MRSA colonization was seen in 17 (1.1%) children with a 95% CI 6, 17.

All the MRSA strains were susceptible to the non-betalactam drugs tested and 47.1% (8/17) of them were positive for urease test. pvl gene was detected in 59% (10/17) of MRSA isolates [Figure 1].
Figure 1: Pvl gene detection of MRSA colonizing the anterior nares of school children Lane 1 to 4: Samples, lane 5: Negative control, lane 6: 100 bp ladder

Click here to view


Strains that possessed ccr B2 (at 311 bp), dcs (at 342 bp) and mecA (162 bp) gene were identified as SCC mec type IV. SCC mec type V possessed ccr C gene at 449 bp J1 region at 377 bp position with mecA gene. Among the MRSA isolates seven strains were found to be SCC mec type IV [Figure 2] and none of them were type V. All the type IV strains were further confirmed with IS 1272 PCR assay and all of them possessed IS 1272 which was evidenced by the presence of a band at 1.4 kb position after PCR.
Figure 2: Multiplex PCR for SCC mec typing of MRSA colonizing the anterior nares of school children Lane 1: 50 bp ladder, lane 2: USA 300 (SCC mec IV), lane 3: WCH 1000 (SCC mec V) lane 4: EMRSA 15 (R0 1087), lane 5 to 8: Samples

Click here to view


PFGE was performed with 4 strains of MRSA. The banding pattern of all our isolates resembles a variant of EMRSA-15 which was isolated and identified as an Indian variant of EMRSA-15 earlier. [8],[11] This variant isolate was included as a reference strain in this study. The PFGE pattern of these current strains and the Indian variants differed from the classical EMRSA 15 by 3-4 bands and was closely related to it [Figure 3].
Figure 3: PFGE of selected MRSA isolates colonizing anterior nares of school children of Udupi taluk and clincal isolate along with controls Lane 1: Classical EMRSA-15, lane 2 to 5: Samples, lane 6: Indian variant EMRSA-15, lane 7: NCTC 8325 (HA-MRSA)

Click here to view



 ~ Discussion Top


HA-MRSA is considered as multi drug resistant while CA-MRSA in general shows resistance only to beta lactam antibiotics such as penicillin and cephalosporin groups. This is attributed to the low number of drug resistance gene harbored by the short SCC mec (21-25 kb) element of CA-MRSA compared to the large cassettes (34-67 kb) of HA-MRSA. [15] The resistance pattern of all the current study isolates are characteristic of CA-MRSA type. Emergence of CA-MRSA as a health care associated pathogen is a challenging issue. This was even pointed out by Seybold et al., in one of their reports. [16] A recent report by Dhawan et al., adds more strength to this alarming fact as they noticed the emergence of SCC mec type IV and V clones of MRSA in an Indian hospital. [17] Boucher et al., in their review article exemplified a case of multi-drug resistant CA-MRSA infection. [18] Major consequence of such infections is the treatment failure. A soothing fact to be noted here is the absence of such multi-drug resistant MRSA in our study settings. This indicates that neither HA-MRSA has invaded into our community settings nor CA-MRSA has acquired multi-drug resistance genes.

When it comes to the question of molecular type of MRSA colonizing the children in this study area, a large proportion (59%) has been found to be producing PVL toxin. It is a matter of immediate concern that needs to be addressed effectively, lest it should become a threat to the control of infectious diseases. A regular screening of children for MRSA colonization at the time of hospitalization would go a long way in controlling the spread of such infections. PVL production though not a unique feature of MRSA, the virulence associated with it is sufficient to cause severe skin and soft tissue infections such as necrotizing fasciitis or necrotizing pneumonia. [11],[19] Occurrence of a significant proportion PVL positive CA-MRSA, utmost care and caution need to be exercised in dealing with the MRSA carriers. A much welcome approach would be to include PVL detection also as an integral part of the routine diagnostic panel of MRSA infections.

SCC mec typing has become more popular and accepted molecular typing technique among microbiologists and epidemiologists as a method to discriminate HA and CA-MRSA types. Employing this technique we could detect 41% MRSA strains from the anterior nares of school children classified as SCC mec IV with a total absence of type V.

DNA finger printing by PFGE is considered as the 'gold standard' test for epidemiological typing of MRSA which normally is adopted in outbreak investigations of infectious diseases, thanks to its high discriminating power, reproducibility and reliability. [20] Only four random selected strains were subjected to the above mentioned method. The classical EMRSA-15, NCTC 13142, NCTC 8325 and an Indian variant EMRSA-15 isolated at Bangalore [8] were used as reference strains. The rationale for selecting EMRSA-15 as one of the references was the recent reports on the emergence EMRSA-15 infections in South East Asian countries. [8],[9],[21],[22] None of the strains studied were identical to NCTC 8325 strain (HA-MRSA) in their PFGE pattern. However, the strains can be assigned as the Indian variant EMRSA-15 in spite of there being a variation in only 3-4 bands of the classical EMRSA-15 (NCTC 13142). Almost all the CA-MRSA isolates (6/7) collected from the school children belonged to the urease non-producing category, an observation which has been well recognized [23],[24] as a feature of EMRSA-15.

The findings obtained so far bear ample testimony to the fact that all MRSA strains endemic in this region (Udupi taluk) originally belonged to a single clone identical to the Indian variant of EMRSA-15 irrespective of the source. The epidemiological significance of the latter gets enhanced through the acquisition of pvl gene. Perhaps, the minor difference in the banding pattern of current study isolates in comparison with those of classical EMRSA-15 in PFGE, accounts for the probable genetic changes that the strain would have inherited during the evolution process.

Emergence of the virulent Indian variant EMRSA-15 in our community is a worrisome fact to be reckoned with, notwithstanding the low prevalence of nasal colonization of MRSA (1.1%). It is necessary to take actions to prevent the spread of this virulent CA-MRSA by destroying them at the source itself. This can be achieved by decolonizing carriers using mupirocin ointment. Quarantining and decolonizing the carriers identified by conducting regular screening programmes for inpatients in hospitals will also be a good measure to prevent the spread of such CA-MRSA infection. Highly organized precautionary measures like usage of hand rubs and periodic screening for carriers of MRSA among health care professionals are warranted for an effective control of the spread of these deadly strains, in the light of the findings evolved from this epidemiological study.

 
 ~ References Top

1.
Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant staphylococcus aureus, United States, 1999-2005. Emerg Infect Dis 2007;13:1840-6.  Back to cited text no. 1
    
2.
Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, et al. Active Bacterial Core surveillance (ABCs) MRSA Investigators. Invasive methicillin-resistant staphylococcus aureus infections in the United States. JAMA 2007;298:1763-71.  Back to cited text no. 2
    
3.
From the centers for disease control and prevention. Four pediatric deaths from community acquired methicillin resistant Staphylococcus aureus - Minnesota and North Dakota, 1997 - 1999. JAMA 1999;282:1123-5.  Back to cited text no. 3
    
4.
Fomda BA, Thokar MA, Khan A, Bhat JA, Zahoor D, Bashir G, et al. Nasal carriage of Methicillin-resistant Staphylococcus aureus among healthy population of Kashmir, India. Indian J Med Microbiol 2014;32:39-43.  Back to cited text no. 4
[PUBMED]  Medknow Journal  
5.
Labandeira-Rey M, Couzon F, Boisset S, Brown EL, Bes M, Benito Y, et al. Staphylococcus aureus panton valentine leucocidine causes necrotizing pneumonia. Science 2007;315:1130-3.  Back to cited text no. 5
    
6.
Holmes A, Ganner M, McGuane S, Pitt TL, Cookson BD, Keavns AM. Staphylococcus aureus isolates carrying panton valentine leucocidine genes in England and Wales: Frequency, characterization and association with clinical disease. J Clin Microbiol 2005;43:2384-90.  Back to cited text no. 6
    
7.
Katayama Y, Ito T, Hiramatsu K. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 2000;44:1549-55.  Back to cited text no. 7
    
8.
Arakere G, Nadig S, Swedberg G, Macaden R, Amarnath SK, Raghunath D. Genotyping of methicillin-resistant Staphylococcus aureus strains from two hospitals in Bangalore, South India. J Clin Microbiol 2005;43:3198-202.  Back to cited text no. 8
    
9.
Nadig S, Ramachandra Raju S, Arakere G. Epidemic meticillin-resistant Staphylococcus aureus (EMRSA-15) variants detected in healthy and diseased individuals in India. J Med Microbiol 2010;59:815-21.  Back to cited text no. 9
    
10.
D'Souza N, Rodrigues C, Mehta A. Molecular characterization of methicillin-resistant Staphylococcus aureus with emergence of epidemic clones of sequence type (ST) 22 and ST 772 in Mumbai, India. J Clin Microbiol 2010;48:1806-11.  Back to cited text no. 10
    
11.
Govindan S, Chakrakodi B, Prabhakara S, Arakere G, Kumar S, Bairy I. Necrotizing fasciitis caused by a variant of epidemic methicillin resistant Staphylococcus aureus -15. Indian J Med Microbiol 2012;30:476-9.  Back to cited text no. 11
[PUBMED]  Medknow Journal  
12.
CLSI (2009), Performance Standards for Antimicrobial Susceptibility Testing, 19 th Informational Supplement. M100-S19. Wayne, PA: Clinical and Laboratory Standards Institute.  Back to cited text no. 12
    
13.
Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999;29:1128-32.  Back to cited text no. 13
    
14.
Milheirico C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for the assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 2007;51:3374-7.  Back to cited text no. 14
    
15.
Okuma K, Iwakawa K, Turnidge JD, Grubb WB, Bell JM, O'Brien FG, et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J Clin Microbiol 2002;40:4289-94.  Back to cited text no. 15
    
16.
Seybold U, Kourbatova EV, Johnson JG, Halvosa SJ, Wang YF, King MD, et al. Emergence of community-associated methicillin-resistant Staphylococcus aureus USA 300 genotype as a major cause of health care-associated blood stream infections. Clin Infect Dis 2006;42:647-56.  Back to cited text no. 16
    
17.
Dhawan B, Rao C, Udo EE, Gadepalli R, Vishnubhatla S, Kapil A. Dissemination of methicillin-resistant Staphylococcus aureus SCCmec type IV and SCCmec type V epidemic clones in a tertiary hospital: Challenge to infection control. Epidemiol Infect 2014;2:1-11.  Back to cited text no. 17
    
18.
Boucher HW, Corey GR. Epidemiology of methicillin resistant Staphylococcus aureus. Clin Infect Dis 2008;46:s344-9.  Back to cited text no. 18
    
19.
Dickson RP, Martinez SM, Ortiz JR. A case of rapidly progressive necrotizing pneumonia caused by community-acquired methicillin-resistant Staphylococcus aureus. Respir Care 2008;53:1223-6.  Back to cited text no. 19
    
20.
Strandén A, Frei R, Widmer AF. Molecular typing of methicillin-resistant Staphylococcus aureus: Can PCR replace pulsed-field gel electrophoresis? J Clin Microbiol 2003;41:3181-6.  Back to cited text no. 20
    
21.
Udo EE, Al-Sweih N, Noronha B. Characterisation of non-multiresistant methicillin-resistant Staphylococcus aureus (including EMRSA-15) in Kuwait Hospitals. Clin Microbiol Infect 2006;12:262-9.  Back to cited text no. 21
    
22.
Hsu LY, Loomba-Chlebicka N, Koh YL, Tan TY, Krishnan P, Lin RT, et al. Evolving EMRSA-15 epidemic in Singapore hospitals. J Med Microbiol 2007;56:376-9.  Back to cited text no. 22
    
23.
O'Neill GL, Murchan S, Gil-Setas A, Aucken HM. Identification and characterization of phage variants of a strain of epidemic methicillin-resistant Staphylococcus aureus (EMRSA-15). J Clin Microbiol 2001;39:1540-8.  Back to cited text no. 23
    
24.
Wolter DJ, Chatterjee A, Varman M, Goering RV. Isolation and characterization of an epidemic methicillin-resistant Staphylococcus aureus 15 variant in the central United States. J Clin Microbiol 2008;46:3548-9.  Back to cited text no. 24
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04