Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1816 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (408 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~  References
 ~  Article Tables

 Article Access Statistics
    Viewed3553    
    Printed110    
    Emailed0    
    PDF Downloaded265    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2015  |  Volume : 33  |  Issue : 4  |  Page : 524-527
 

Outbreak of chickenpox in a Union Territory of North India


1 Department of Virology, Post Graduate Institute of Medical Education and Research, Chandigarh, India
2 Department of Community Medicine, School of Public Health, Post Graduate Institute of Medical Education and Research, Chandigarh, India

Date of Submission27-Jun-2014
Date of Acceptance01-May-2015
Date of Web Publication16-Oct-2015

Correspondence Address:
M P Singh
Department of Virology, Post Graduate Institute of Medical Education and Research, Chandigarh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.167335

Rights and Permissions

 ~ Abstract 

Purpose: Primary infection with a varicella-zoster virus (VZV) leads to chickenpox. Though the incidence of the disease has decreased in many developed countries due to the introduction of the varicella vaccine, outbreaks continue to occur in developing countries. Materials and Methods: The present study reports an outbreak of varicella in an urbanised village in the vicinity of Chandigarh City in North India in November 2013. The outbreak was confirmed by the detection of VZV IgM antibodies in serum samples of clinically suspected patients. Vesicular fluid samples were collected from 8 patients with active lesions and tested for VZV DNA by polymerase chain reaction. Blood samples were also collected from 17 healthy controls residing in the same locality and tested for the presence of VZV IgM and IgG antibodies. Results: A total of 18 cases occurred, and the majority of them (67%) were <15 years of age. Of 17 samples collected from patients with the clinically suspected disease, 13 (76.5%) showed the presence of VZV IgM antibodies. Of the healthy controls, 6 were VZV IgM positive and 4 of them developed symptomatic disease on follow-up. VZV DNA was positive in 5/8 (62.5%) of the patients. In one patient, VZV DNA was detected in the absence of an IgM antibody response. Conclusion: The introduction of varicella vaccine in the universal immunisation programme of India may help to prevent these outbreaks; however, the cost-benefit analysis needs to be carried out before making such policies.


Keywords: India, outbreak, union territory, varicella zoster


How to cite this article:
Singh M P, Chandran C, Sarwa A, Kumar A, Gupta M, Raj A, Ratho R K. Outbreak of chickenpox in a Union Territory of North India. Indian J Med Microbiol 2015;33:524-7

How to cite this URL:
Singh M P, Chandran C, Sarwa A, Kumar A, Gupta M, Raj A, Ratho R K. Outbreak of chickenpox in a Union Territory of North India. Indian J Med Microbiol [serial online] 2015 [cited 2019 Dec 14];33:524-7. Available from: http://www.ijmm.org/text.asp?2015/33/4/524/167335



 ~ Introduction Top


Chicken pox or varicella is an acute infectious disease of childhood caused by varicella-zoster virus (VZV), belonging to the family Herpesviridae. Human beings are the only known hosts of this virus. The primary infection presents as fever and exanthematous rash but can affect almost any organ of the body. The incubation period usually ranges between 7 and 23 days (mean-2 weeks). The major route of transmission is airborne, however, transmissions via aerosols or direct contact with the blister fluid have also been reported.[1] The disease is highly contagious with an attack rate of >85% after exposure. A clinically apparent infection usually provides lifelong immunity. The disease is usually acute and self-limited but occasionally can lead to complications such as encephalitis, pneumonia, and secondary bacterial infections. The long-term consequences of the disease include the development of herpes zoster, which occurs due to reactivation of latent varicella infection.[2]

Chickenpox is primarily a disease of the temperate regions where it occurs throughout the year, commonly in children between 1 and 14 years of age.[3],[4] The prevalence of the disease in these areas is 13–16/1000 people per year. The scenario is, however, different in tropical regions where the disease preferably occurs during the cooler seasons such as winter and spring, and affects mainly adolescents and young adults. The fact that, chicken pox is more severe in adults than in children [5],[6] suggests that tropical countries may be at a higher risk of morbidity and mortality due to the disease.

Varicella is one of the leading causes of vaccine-preventable deaths in children.[7] The varicella vaccine is available commercially and may provide protection against 85% cases of chicken pox and 95% cases of severe secondary sequelae.[8] Prior to 1995, nearly 4 million cases of chicken pox occurred each year in the Unites States leading to 11,000 hospital admissions and 100 deaths.[9] However, the introduction of universal vaccination in many countries such as Japan, Korea,[10] and United States of America [11] has led to dramatic reduction in the varicella incidence, its associated complications, hospitalisations, and fatality rate.[7] The published data on the epidemiology of chicken pox in India is scarce as it was not a notifiable disease till 2005. The varicella vaccine is not a part of the Universal Immunisation Programme in India,[12] hence outbreaks of chickenpox continue to occur in the naive unvaccinated rural population.[13],[14]

The present study reports an outbreak of varicella which occurred in Burail, a field practice area of School of Public Health, Post-Graduate Institute of Medical Education and Research, Chandigarh which has approximately a population of about 34,000. The houses in the area are multi-storeyed ranging from 3 to 5 floors and having 15–20 rooms on each floor. Each room is occupied by an individual household, which include 5–7 family members. Overcrowding, poor ventilation, and lower educational status possibly promoted the spread of the virus in this locality.


 ~ Materials and Methods Top


The Department of Virology was informed of an outbreak of fever with rash in Burail in the 3rd week of November, 2013 by the School of Public Health. An active surveillance of the affected locality was carried out, and blood samples were collected from 17 affected patients as a part of the outbreak investigation. A clinical case of chicken pox was defined as the occurrence of maculopapular rash in any person of any age after 23rd October 2013. A confirmed case was defined as any case with clinical evidence suggestive of chicken pox along with laboratory confirmation of the disease either by serology or nucleic acid detection or by both.[15]

Additional vesicular swab samples were also collected from 8 cases presenting with active skin lesions. Blood samples were also collected from 17 age and sex matched healthy subjects residing in the same community who had never suffered from chicken pox in the past. All the samples were collected after obtaining an informed written consent from the adult cases and from the parents in case of minor children. The samples were transported to the virology laboratory in the cold chain. The study was approved by the Institutional Ethics Committee as per the national guidelines.

Serology

Sera were separated and stored at −70°C in aliquots until tested. The VZV specific IgM and IgG antibodies were detected using commercially available kits (Demeditec diagnostics, GmbH, Germany) as per the manufacturer's instructions.

Polymerase chain reaction

The DNA was extracted from the vesicular swabs using commercially available kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The DNA was finally eluted in 50 µL of elution buffer. It was then subjected to polymerase chain reaction (PCR) targeting ORF28 gene of VZV.[16] The PCR was performed in 25 µL volume reactions containing 5 µL of DNA. The reaction mixture consisted of 1X PCR buffer (10 mM Tris with 15 mM MgCl2), 1 µM of each primer, 200 µM of dNTPs, and 0.5 U Taq polymerase. The thermocycler conditions were 94°C for 3 min followed by 39 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 45 s and final extension at 72°C for 3 min. The amplicons of 355 bp were visualised by gel electrophoresis using 2% agarose gel followed by ethidium bromide staining. The following primers were used:

Forward primer: 5'ATCGCGGCTTGTTGTTTGTCTAAT3'.

Reverse primer: 5'GGGCGAAATGTAGGATATAAAGGA 3'.

The representative samples were sequenced and submitted to the Gen Bank vide accession numbers KJ419348 and KJ419349.


 ~ Results Top


Demography

A total of 18 laboratory confirmed cases of varicella occurred in the present outbreak. The age of the patients ranged from 4 months to 25 years (mean age - 12 years). The majority (67%) of the affected cases were <15 years of age. Of the 18 cases, 4 were males, and 14 were females (M: F ratio - 1:3.5).

Clinical features

The most common clinical manifestations observed were rash (100%) and fever (89%). The rash was generalised in all of the cases, and the first site was the trunk in the majority (78%) of the patients. The typical presentation was vesicles (66.6%, 12/18) followed by a maculopapular rash with the majority (78%) of the patients presenting with 50–249 lesions. The history of contact with a case of chickenpox was available in all the patients while none of them gave a history of vaccination against VZV. All the cases recovered spontaneously without any major complications.

Serological profile

On testing the blood samples received from 17 clinically suspected cases, VZV IgM antibodies could be detected in 13 (76.5%) cases, and VZV IgG antibodies were detected in 9 (52.9%) cases. A total of 11 (64.7%) patients showed the presence of both VZV IgM and IgG antibodies.

Of the 17 healthy controls, VZV IgM antibodies were positive in 6 controls (35.29%), and IgG antibodies could be detected in 6 (35.29%) subjects. The six asymptomatic VZV IgM positive, healthy controls were followed up, and four developed clinical disease while the remaining two remained asymptomatic.

Polymerase chain reaction

Of the eight vesicular swab samples from patients with active lesions, VZV DNA could be detected in 5 samples (62.5%). Of these, five positive samples, four were also positive for VZV IgM antibodies. [Table 1] shows the details of active varicella cases along with their serological and molecular profile.
Table 1: The detailed demographic, serological

Click here to view



 ~ Discussion Top


The present study describes a focal outbreak of chicken pox that occurred in an urbanised village located on the outskirts of a well-planned modern city in Northern India. This area is over-populated with the residents living in poorly engineered houses with poor ventilation facilities, which led to the spread of the virus. Outbreaks of chicken pox have previously been reported worldwide and also from India.[17] Nosocomial outbreaks have been reported in the institutional set-ups involving the health care personnel.[18],[19] In an outbreak among nursing students in a tertiary health care centre, the index case spread the disease to eight other students. In another outbreak from Rajasthan, 14 health care workers in a tertiary care hospital acquired the infection from a 23 years old renal transplant recipient.[18],[19] A community-wide outbreak has also been reported around Chandigarh wherein a total of 162 cases occurred.[20] This particular outbreak was traced back to a primary case who was a 20-year-old female tutor. Her diagnosis was missed by a primary health care worker and the disease spread to her contacts.

In the present outbreak, the index case was a 2-year-old female child suffering from fever and rash in the 3rd week of November 2013. An active surveillance revealed that the primary case was a 10-year-old school going male child who developed symptoms on 23rd October 2013. This child spread the disease to few of his classmates who in turn spread the disease to their household and neighbourhood contacts. The majority of affected cases were children which is typical of chicken pox. Most of the patients had typical vesicular lesions, which were commonly seen on the trunk while a few had lesions on the scalp, face, and extremities.

A total of 18 laboratory confirmed cases of varicella occurred in the present outbreak. The typical laboratory diagnosis of VZV rests on the detection of VZV specific IgM antibodies, which could be detected in 76.5% (13/17) of the clinically suspected cases. Viral DNA was detected in the vesicular swab of 62.5% (5/8) cases, one of whom was negative for VZV IgM antibodies. Of the 18 laboratory cases, 13 were the patients with the clinically suspected disease who were positive for VZV IgM antibodies. Four patients were actually enrolled in the study as healthy controls but were further followed up owing to the VZV IgM antibody positivity and developed the disease (possibly in the incubation phase at the time of sample collection) while one case was VZV DNA positive in the absence of an IgM antibody response. The absence of antibody response in the latter case may be explained by the fact that the blood sample was collected on the day 1 of the illness which is too early for an IgM antibody response to appear. In the present study, two patients were found to have subclinical infections since they were positive for VZV IgM antibodies but did not develop any disease on subsequent follow-up.[21] The VZV IgG positivity in 31% of the controls can be attributed to past infection with the virus.

Detection of the viral genome by PCR in the vesicular swab samples yielded positive results in 62.5% of the total samples tested. The viral DNA could be detected from the vesicular swab samples even up to 7 days after the onset of illness. Studies have shown that the detection of VZV from vesicle swabs had a sensitivity of 97–100%[22] which is much higher than that of electron microscopy and culture methods.[23] It has also been shown that PCR from the vesicle fluid is a highly sensitive technique and can detect even 6 copies of the virus and hence may be very useful for early diagnosis.[24] This will help in the early isolation of the patients, thereby preventing the spread of the outbreak.

The Indian Academy of Paediatrics - Committee on Immunisation recommends the administration of varicella vaccine in children aged 15 months or older.[19] Many preparations of the vaccine are available all over India in the private sector and as per the recommendation, the first dose should be given at an age of 15 months followed by a second dose at 4–6 years. However, this vaccine is not being given in the Universal Immunisation Programme, so the countrywide coverage is inadequate leading to frequent outbreaks. Puri et al. have reported a coverage as low as 2.8% in under five children in Chandigarh with the majority (91.9%) of them being immunised in the private sector.[25] This is quite lower as compared to the 86–91% vaccination coverage to establish the necessary herd immunity to prevent outbreaks.[26] This poor vaccination coverage, along with overcrowding, the ambient temperature during winters, and the poor literacy rate of the population facilitated the easy spread of the virus. The efficacy of the varicella vaccine can be shown by the fact that it can reduce the severity of the illness even if it is used within 3-5 days after exposure to the infection.[27] In conclusion, present paper highlights the need for varicella vaccine introduction in the Indian immunisation schedule to prevent outbreaks in community settings as has been documented after the introduction of a two-dose varicella vaccination programme in United States of America.[28] However, this is an expensive vaccine and in developing countries like India the cost-benefit analysis needs to be carried out before implementing any such policies.[12]

 
 ~ References Top

1.
Ozaki T, Kajita Y, Namazue J, Yamanishi K. Isolation of varicella-zoster virus from vesicles in children with varicella. J Med Virol 1996;48:326-8.  Back to cited text no. 1
    
2.
Nagel MA, Gilden D. Complications of varicella zoster virus reactivation. Curr Treat Options Neurol 2013;15:439-53.  Back to cited text no. 2
    
3.
Preblud SR. Varicella: Complications and costs. Pediatrics 1986;78:728-35.  Back to cited text no. 3
    
4.
Struewing JP, Hyams KC, Tueller JE, Gray GC. The risk of measles, mumps, and varicella among young adults: A serosurvey of US Navy and Marine Corps recruits. Am J Public Health 1993;83:1717-20.  Back to cited text no. 4
    
5.
Guess HA, Broughton DD, Melton LJ 3rd, Kurland LT. Population-based studies of varicella complications. Pediatrics 1986;78:723-7.  Back to cited text no. 5
    
6.
Baren JM, Henneman PL, Lewis RJ. Primary varicella in adults: Pneumonia, pregnancy, and hospital admission. Ann Emerg Med 1996;28:165-9.  Back to cited text no. 6
    
7.
Prevention of varicella. Update recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recomm Rep 1999;48:1-5.  Back to cited text no. 7
    
8.
Vázquez M, LaRussa PS, Gershon AA, Steinberg SP, Freudigman K, Shapiro ED. The effectiveness of the varicella vaccine in clinical practice. N Engl J Med 2001;344:955-60.  Back to cited text no. 8
    
9.
Centers for Disease Control and Prevention (CDC). Decline in annual incidence of varicella – selected states, 1990-2001. MMWR Morb Mortal Wkly Rep 2003;52:884-5.  Back to cited text no. 9
    
10.
Sadzot-Delvaux C, Rentier B, Wutzler P, Asano Y, Suga S, Yoshikawa T, et al. Varicella vaccination in Japan, South Korea, and Europe. J Infect Dis 2008;197 Suppl 2:S185-90.  Back to cited text no. 10
    
11.
Marin M, Güris D, Chaves SS, Schmid S, Seward JF; Advisory Committee on Immunization Practices, Centers for Disease Control and Prevention (CDC). Prevention of varicella: Recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recomm Rep 2007;56:1-40.  Back to cited text no. 11
    
12.
Verma R, Bairwa M, Chawla S, Prinja S, Rajput M. Should the chickenpox vaccine be included in the National Immunization Schedule in India? Hum Vaccin 2011;7:874-7.  Back to cited text no. 12
    
13.
Sinha DP. Chickenpox – A disease predominantly affecting adults in rural West Bengal, India. Int J Epidemiol 1976;5:367-74.  Back to cited text no. 13
    
14.
Balraj V, John TJ. An epidemic of varicella in rural southern India. J Trop Med Hyg 1994;97:113-6.  Back to cited text no. 14
    
15.
CDC, Chickenpox (Varicella). Varicella Reporting: Case Definition. Available from: http://www.cdc.gov/chickenpox/hcp/conducting-surveillance.html. Last accessed on 2015 May 20  Back to cited text no. 15
    
16.
Zhang Y, Kimura T, Fujiki K, Sakuma H, Murakami A, Kanai A. Multiplex polymerase chain reaction for detection of herpes simplex virus type 1, type 2, cytomegalovirus, and varicella-zoster virus in ocular viral infections. Jpn J Ophthalmol 2003;47:260-4.  Back to cited text no. 16
    
17.
Dikid T, Pala S, Ratho RK, Singh MP, Singh AJ. Chickenpox outbreak in North India: People vs administrative response. South Asian J Socio Polit Stud 2010;10:36-41.  Back to cited text no. 17
    
18.
Bhatti VK, Budhathoki L, Kumar M, Singh G, Nath A, Nair GV. Use of immunization as strategy for outbreak control of varicella zoster in an institutional setting. Med J Armed Forces India 2014;70:220-4.  Back to cited text no. 18
    
19.
Sood S. Occupationally related outbreak of chickenpox in hospital staff: A learning experience. J Clin Diagn Res 2013;7:2294-5.  Back to cited text no. 19
    
20.
Singh MP, Singh G, Kumar A, Singh A, Ratho RK. Epidemiologic lessons: Chickenpox outbreak investigation in a rural community around Chandigarh, North India. Indian J Pathol Microbiol 2011;54:772-4.  Back to cited text no. 20
[PUBMED]  Medknow Journal  
21.
Harper DR, Grose C. IgM and IgG responses to varicella-zoster virus p32/p36 complex after chickenpox and zoster, congenital and subclinical infections, and vaccination. J Infect Dis 1989;159:444-51.  Back to cited text no. 21
    
22.
Binkhamis K, Al-Siyabi T, Heinstein C, Hatchette TF, LeBlanc JJ. Molecular detection of varicella zoster virus while keeping an eye on the budget. J Virol Methods 2014;202:24-7.  Back to cited text no. 22
    
23.
Beards G, Graham C, Pillay D. Investigation of vesicular rashes for HSV and VZV by PCR. J Med Virol 1998;54:155-7.  Back to cited text no. 23
    
24.
Hawrami K, Harper D, Breuer J. Typing of varicella zoster virus by amplification of DNA polymorphisms. J Virol Methods 1996;57:169-74.  Back to cited text no. 24
    
25.
Puri S, Bhatia V, Singh A, Swami HM, Kaur A. Uptake of newer vaccines in Chandigarh. Indian J Pediatr 2007;74:47-50.  Back to cited text no. 25
    
26.
Plans-Rubió P. Evaluation of the establishment of herd immunity in the population by means of serological surveys and vaccination coverage. Hum Vaccin Immunother 2012;8:184-8.  Back to cited text no. 26
    
27.
Shahbazian H, Ehsanpour A. An outbreak of chickenpox in adult renal transplant recipients. Exp Clin Transplant 2007;5:604-6.  Back to cited text no. 27
    
28.
Bialek SR, Perella D, Zhang J, Mascola L, Viner K, Jackson C, et al. Impact of a routine two-dose varicella vaccination program on varicella epidemiology. Pediatrics 2013;132:e1134-40.  Back to cited text no. 28
    



 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04