Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1903 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (395 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed3020    
    Printed61    
    Emailed0    
    PDF Downloaded128    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
BRIEF COMMUNICATION
Year : 2015  |  Volume : 33  |  Issue : 2  |  Page : 290-292
 

A simple and rapid method for the quantitation of secreted hepatitis B virions in cell culture models


Kusuma School of Biological Sciences, Indian Institute of Technology Delhi, New Delhi, India

Date of Submission19-Mar-2014
Date of Acceptance11-Sep-2014
Date of Web Publication10-Apr-2015

Correspondence Address:
P Vivekanandan
Kusuma School of Biological Sciences, Indian Institute of Technology Delhi, New Delhi
India
Login to access the Email id

Source of Support: DBT funded project (SAN.No.102/IFD/SAN/PR- 2454/2010-2013), Conflict of Interest: None


DOI: 10.4103/0255-0857.153568

Rights and Permissions

 ~ Abstract 

Cell culture models for hepatitis B virus (HBV) remain the mainstay for screening and testing the efficacy of anti-hepatitis B virus agents. Gradient-based ultracentrifugation followed by Southern Blotting is used for hepatitis B virion estimation in cell culture; this method has several limitations. We report the development of an assay using a commercially available HBsAg-ELISA plate for immunocapture followed by real-time PCR for quantification of hepatitis B virions in cell cultures. This assay is rapid, highly sensitive (50 copies/reaction) and highly specific for virion-associated DNA. In addition, the assay requires only 20 μL of supernatant, allowing scaling down of transfections.


Keywords: ELISA, HBV, immunocapture, quantitative, real time, supernatant


How to cite this article:
Samal J, Kandpal M, Vivekanandan P. A simple and rapid method for the quantitation of secreted hepatitis B virions in cell culture models. Indian J Med Microbiol 2015;33:290-2

How to cite this URL:
Samal J, Kandpal M, Vivekanandan P. A simple and rapid method for the quantitation of secreted hepatitis B virions in cell culture models. Indian J Med Microbiol [serial online] 2015 [cited 2019 Aug 20];33:290-2. Available from: http://www.ijmm.org/text.asp?2015/33/2/290/153568



 ~ Introduction Top


Human hepatoma-derived cell lines are widely used for the study of hepatitis B virus (HBV) replication due to lack of good small animal models. [1] In cell culture models, HBV mutants including drug-resistant mutants influence HBV replication resulting in reduced virion production. [2],[3] Currently available methods for quantification of secreted hepatitis B virions in cell culture are summarized in [Table 1]. The classical and most widely used method is the CsCl gradient-based ultracentrifugation followed by Southern Blotting. [6],[8],[9] However, gradient-based ultracentrifugation has inherent disadvantages: (a) lt does not provide quantitative information, (b) It requires large volumes of cell culture supernatant, (c) Detection often requires the use of radioactivity and (d) it is labour-intensive.
Table 1: Currently available methods for Hepatitis B virion - associated DNA estimation


Click here to view


Estimation of secreted hepatitis B virions in cell culture supernatant is critical for understanding replication characteristics of HBV variants, drug resistant mutants and in screening and efficacy testing of anti-HBV drugs. Therefore, the need for a simple and specific assay for absolute quantification of secreted hepatitis B virions in cell culture models is being increasingly realized.

We report the development and validation of a simple, rapid and sensitive assay for the absolute quantification of hepatitis B virions in cell culture models. Briefly, commercially available monoclonal anti-HBs coated HBsAg ELISA plates were used to capture virions followed by DNA extraction and quantification using real-time PCR. The immunocapture followed by real-time PCR assay provides high specificity for virion-associated HBV DNA and eliminates noise from non-virion associated DNA (a major problem in currently available methods using DNase I).


 ~ Materials and Methods Top


This work has been approved by the department and institute research committee. It does not require ethics committee approval as it does not involve human subjects.

Huh7 cells were seeded in 6-well plates and transfected with replication-competent wild type HBV constructs created as described previously. [10] To investigate if this assay eliminated background signal from non-virion associated DNA, we created Pkex-1+2 mutant construct (mutation in the epsilon region of HBV genome) which is replication incompetent. [11] Culture supernatants (100 μL each) from the transfected Huh7 cells (5 days post-transfection) and stably transfected HepG2.2.15 cell line were collected and subjected to DNase I (NEB, MA, USA) digestion for 30 minutes at 37 ° C to digest non-virion associated HBV DNA, then added to ELISA microplate wells coated with monoclonal anti-HBs antibodies (Monolisa HBsAg ULTRA ELISA kit, Bio-Rad, CA, USA) and incubated at 37°C for 90 minutes. Subsequently, the microplate wells were washed with PBS (Genetix Biotech, New Delhi, India), treated with Proteinase K and lysis buffer and then DNA was extracted as per the manufacturer's instructions (QIAamp DNA Blood mini kit, Qiagen, Valencia, USA). Two microlitres of DNA extracted from the captured virions was quantitated in a real-time PCR assay using primers (IDT) (V-F: 5′GGTCTGCGCACCAGCACC3′ and V-R: 5′GAACTTTAGGCCCATATTAGTG3′) specifically designed not to amplify transfected HBV DNA. The amplification conditions were as follows: 95°C for 2 minutes, followed by 36 cycles of 95°C for 5 seconds and 60.5°C for 5 seconds.

To test if small volumes of supernatants could be used in our assay to obtain quantitative information, we tested dilutions of the supernatant including 1:2, 1:4, 1:10 and 1:20 [Figure 1]a, where 50 μl, 25 μl, 10 μl and 5 μl of the supernatant was diluted to a total volume of 100 μl (in PBS) prior to immunocapture followed by real-time PCR.
Figure 1: (a) Quantitative estimation of secreted hepatitis B virions in cell culture supernatant. Secreted hepatitis B virions were estimated in undiluted supernatants and in dilutions of supernatants using immunocapture followed by quantification of virion-associated DNA using a real time PCR. Two-fold differences in quantity of secreted virions were accurately detected using our assay. No virion-associated DNA was detected from pkex 1+2 (a replication and packaging deficient mutant) and spiked DNA (growth medium spiked with 50 μL of wild type HBV constructs at a concentration of 1010 copies/mL was added to ELISA plates for immunocapture). (b) Effect of lamivudine on virion secretion. Wild type HBV constructs were transfected in Huh7 cells without lamivudine (0 μM) or with varying concentrations of lamivudine (1 μM, 5 μM and 10 μM). Cell culture supernatants (20 μL each) were used for immunocapture followed by real time PCR for quantitation of secreted virions. The lamivudine-induced reduction in hepatitis B virion secretion is shown in percentage as compared to the virions secreted in the untreated (0 μM) control. No secreted virions were detected in supernatants with 10 μM of lamivudine

Click here to view



 ~ Results Top


Our assay provides absolute quantitative information on the amount of secreted virions. We demonstrate that our assay could quantitatively detect even small differences in the number of virions secreted into the cell culture medium [Figure 1]a. The specificity of our assay for virion-associated DNA was confirmed by the absence of signal from Pkex-1+2 (replication-incompetent) constructs and growth medium spiked with the wild type construct (10 10 copies/ml) [Figure 1]a. The lower limit of detection of the real-time PCR used to quantify virions is 50 copies/per reaction. To investigate whether excess HBsAg present in the culture supernatant interferes with virion quantification, the culture supernatants from HepG2.2.15 cells were spiked with purified HBsAg (5.3 ng/mL). The difference in the number of estimated virions before and after spiking with extraneous HBsAg was not significant (P > 0.05; data not shown), suggesting that excess HBsAg does not interfere with immunocapture of virions.

Finally, to validate our assay with an anti-HBV drug, we transfected the wild type HBV construct with varying concentrations of lamivudine (0, 1, 5 and 10 μM) and supernatants were harvested at 72 hours post-transfection. We used 20 μL of the supernatant for immunocapture followed by real-time PCR. The dose-dependent reduction in virion secretion with increasing concentrations of lamivudine is shown in [Figure 1]b.


 ~ Discussion Top


We believe that our assay overcomes most if not all limitations of the widely used ultracentrifugation-based methods for the quantification of virions in cell culture models. The assay we describe in this report has the following advantages (a) high sensitivity (b) high specificity for virion-associated HBV-DNA (c) does not require the use of radioactivity and (d) high-throughput compatible. In addition, our assay requires only

20-100 μl of supernatant (as opposed to 5-20 mL required for ultracentrifugation-based methods) allowing scaling down of transfections to a 96-well plate. Furthermore, our assay requires only 5 hours as opposed to 3-5 days required for currently available methods.

Mutations in the surface gene may reduce the binding affinity of HBsAg to the anti-HBs antibody coated on the ELISA plate; this may impair immunocapture of virions with surface gene mutations. However, the Monolisa HBsAg ELISA kit that we used has been successfully used to detect 15 most common and clinically relevant HBsAg mutants. Our assay is not suitable for virion estimation in HBV clones negative for HBsAg using the commercial ELISA kit used for immunocapture; this is the major limitation of the assay we report.

The differences between HBV replication capacity (often measured by the number of pregenomic RNA/ccc DNA) and virion secretion are becoming increasingly relevant. [12] Naturally occurring mutations in HBV genome can influence HBV virion secretion without significantly affecting the levels of replicative intermediates; [2] strengthening the need for assays that allow quantitation of secreted virions. We believe that our assay will help shed more light on poorly understood nuances of HBV replication, virion secretion in particular. In sum, we report a method for the quantitation of secreted hepatitis B virions in cell culture models that may be particularly helpful as a research tool for assessing virion secretion in naturally occurring mutants and for high-throughput screening of anti-HBV drugs in vitro.

 
 ~ References Top

1.
Guha C, Mohan S, Roy-Chowdhury N, Roy-Chowdhury J. Cell culture and animal models of viral hepatitis. Part I: hepatitis B. Lab Anim (NY) 2004;33:37-46.  Back to cited text no. 1
    
2.
Le Pogam S, Yuan TT, Sahu GK, Chatterjee S, Shih C. Low-level secretion of human hepatitis B virus virions caused by two independent, naturally occurring mutations (P5T and L60V) in the capsid protein. J Virol 2000;74:9099-105.  Back to cited text no. 2
    
3.
Khan N, Guarnieri M, Ahn SH, Li J, Zhou Y, Bang G, et al. Modulation of hepatitis B virus secretion by naturally occurring mutations in the S gene. J Virol 2004;78:3262-70.  Back to cited text no. 3
    
4.
Ning X, Nguyen D, Mentzer L, Adams C, Lee H, Ashley R, et al. Secretion of genome-free hepatitis B virus-single strand blocking model for virion morphogenesis of para-retrovirus. PLoS Pathog 2011;7:e1002255.  Back to cited text no. 4
    
5.
Lazar C, Macovei A, Petrescu S, Branza-Nichita N. Activation of ERAD pathway by human hepatitis B virus modulates viral and subviral particle production. PLoS One 2012;7:e34169.  Back to cited text no. 5
    
6.
Ren S, Nassal M. Hepatitis B virus (HBV) virion and covalently closed circular DNA formation in primary tupaia hepatocytes and human hepatoma cell lines upon HBV genome transduction with replication-defective adenovirus vectors. J Virol 2001;75:1104-16.  Back to cited text no. 6
    
7.
Jammeh S, Tavner F, Watson R, Thomas HC, Karayiannis P. Effect of basal core promoter and pre-core mutations on hepatitis B virus replication. J Gen Virol 2008;89:901-9.  Back to cited text no. 7
    
8.
Parekh S, Zoulim F, Ahn SH, Tsai A, Li J, Kawai S, et al. Genome replication, virion secretion, and e antigen expression of naturally occurring hepatitis B virus core promoter mutants. J Virol 2003;77:6601-12.  Back to cited text no. 8
    
9.
Perlman D, Hu J. Duck hepatitis B virus virion secretion requires a double-stranded DNA genome. J Virol 2003;77:2287-94.  Back to cited text no. 9
    
10.
Gunther S, Li BC, Miska S, Kruger DH, Meisel H, Will H. A novel method for efficient amplification of whole hepatitis B virus genomes permits rapid functional analysis and reveals deletion mutants in immunosuppressed patients. J Virol 1995;69:5437-44.  Back to cited text no. 10
    
11.
Fallows DA, Goff SP. Mutations in the epsilon sequences of human hepatitis B virus affect both RNA encapsidation and reverse transcription. J Virol 1995;69:3067-73.  Back to cited text no. 11
    
12.
Qin Y, Tang X, Garcia T, Hussain M, Zhang J, Lok A, et al. Hepatitis B virus genotype C isolates with wild-type core promoter sequence replicate less efficiently than genotype B isolates but possess higher virion secretion capacity. J Virol 2011;85:10167-77.  Back to cited text no. 12
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04