Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 120 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (1,758 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~ Discussion
 ~ Case Report
 ~  References
 ~  Article Figures

 Article Access Statistics
    Viewed2117    
    Printed42    
    Emailed1    
    PDF Downloaded101    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
CASE REPORT
Year : 2015  |  Volume : 33  |  Issue : 1  |  Page : 165-167
 

Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales


1 Department of Microbiology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India
2 Department of Nephrology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India

Date of Submission17-Dec-2013
Date of Acceptance27-Mar-2014
Date of Web Publication5-Jan-2015

Correspondence Address:
U Kalawat
Department of Microbiology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.148435

Rights and Permissions

 ~ Abstract 

Fungal infections are being increasingly reported from immuno-compromised as well as immuno-competent patients. Transplant patients are on long term immunosuppressive therapy which makes them highly vulnerable to opportunistic fungal infections .These infections can be cutaneous or systemic. Several fungi have been reported to be the culprits such as Candida spp., Aspergillus spp., C. neoformans, P. carinii, and zygomycetes group of fungi. Cutaneous infections are most commonly caused by Pityriasis (tinea) versicolor, dermatophytes, and candida sp but these days the demtiaceous fungi are becoming more frequently reported .Here we report a case of post renal transplant cutaneous infection caused by dematiaceous fungus belonging to the order Pleosporales


Keywords: Fungal infection, pleosporale, renal transplant


How to cite this article:
Galipothu S, Kalawat U, Ram R, Kishore C, Sridhar A, Chaudhury A, Kumar V S. Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales. Indian J Med Microbiol 2015;33:165-7

How to cite this URL:
Galipothu S, Kalawat U, Ram R, Kishore C, Sridhar A, Chaudhury A, Kumar V S. Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales. Indian J Med Microbiol [serial online] 2015 [cited 2019 Jul 18];33:165-7. Available from: http://www.ijmm.org/text.asp?2015/33/1/165/148435



 ~ Introduction Top


Renal transplant recipients on long-term graft-preserving immunosuppressive treatment are predisposed to various fungal infections. These infections are primarily of two types: Cutaneous or sub-cutaneous and Systemic. [1]

Although Candida spp., Aspergillus spp., C. neoformans, P. carinii, zygomycetes group of fungi, and the geographically restricted endemic mycoses play a major role in causing fungal infections among solid-organ transplant recipients, infections due to previously uncommon hyaline and dematiaceous filamentous fungi are being increasingly reported. [2]

Pityriasis (tinea) versicolor, dermatophytosis (ring worm), candidiasis are the most common culprits causing cutaneous fungal infections in renal transplant patients. But, despite their rarity in clinical practice, melanised or dematiaceous fungal infections have become increasingly important in immunocompromised as well as apparently healthy individuals. [3]

Here, we present a case report of cutaneous fungal infection caused by a dematiaceous fungi belonging to the order Pleosporales.


 ~ Case Report Top


A 47-year-old male, who had undergone live donor renal transplantation for progressive renal failure due to Cresenteric Glomerulonephritis 8 years back, developed a swelling on right great toe with no history of fever or pain [Figure 1]. There was purulent discharge without signs of acute inflammation. On clinical examination presumptive diagnosis of chronic abscess was made. Patient was on immunosuppressive therapy after renal transplantation. He was a hypertensive but not a known diabetic.
Figure 1: The wound on great toe before treatment

Click here to view


All the relevant investigations were carried out which were as follows- Complete haemogram revealed Hb 7.6 g/dl, WBC count 3,500 Cells/cu.mm, platelet count 0.55 lakhs/cumm. Serum urea was 106 mg/dl, serum creatinine 6.5 mg/dl, serum potassium 3.0 mmol/L, total Bilirubin 1.1 mg/dl, bilirubin (conjugate) 0.2 mg/dl, serum alkaline phosphatase 56 IU/L, and SGOT 26 IU/L. Bleeding time and clotting time were 3 min 30 sec and 7 min 30 sec, respectively, PT 12.5 sec; APTT/PTT 32.0 sec. and INR - 1.06. Serum sodium, total protein and serum albumin were in normal limits. Urine routine showed mild albuminuria. His past history was not significant except an episode of loose motion with decreased platelet count, and worsening renal failure which was evaluated and infection with CMV was diagnosed and treated accordingly.

Pus was drained and sent to the department of microbiology. Gram staining of pus showed plenty of pus cells but no organisms. Ziehl-Neelsen's staining for acid-fast bacilli was negative. Pus was inoculated on blood agar and Mackonkey's agar for aerobic bacterial culture which was incubated at 37 0 C for 48 hours. Pus was also inoculated on Lowenstein-Jensen agar for mycobacterial culture. Culture for aerobic bacteria and mycobacteria were negative. Viral markers for HIV, HCV and HBV were negative.

In suspicion of any possible fungal infection, secretions and wound tissue were sent for fungal culture and KOH mount. Fungus culture was done on saboraud's dextrose agar. KOH mount of the tissue showed dematiceous fungal elements without any hyphae [Figure 2]. Growth on saboraud's agar was slightly velvety; initially whitish in colour which later on became light green [Figure 3]. Lactophenol cotton blue mount was prepared from the growth which showed septate hyphae with structures resembling arthrospores [Figure 4]. As we could not arrive at a diagnosis, the isolate was sent to mycology division, PGI Chandigarh and RAS Life Sciences Pvt. Ltd. Hyderabad, India for molecular detection. Both the centres reported it to be genotypically similar to order Pleosporales and further identification up to species level could not be done due to lack of specific primers.
Figure 2: The direct microscopy of the pus - Dematiceous fungal elements can be seen

Click here to view
Figure 3: The fungal colonies of Saboraud's dextrose agar

Click here to view
Figure 4: The microscopy of the fungal colonies using lactophenol cotton blue

Click here to view


The genomic sequence was as follows:

GAAAAAAAATGCAGGGGGGGGGCAGACAGC TCCAAGGCCGCCGGCCCCCGCGTACACG CATTATCCACCCTTGACTTTGAGCACC GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC TGAAAAAAAACACAAAAATCACAACTTTC AACAATGGATCTCTTGGTTCTGGCA TCGATGAAGAACGCAGCGAAATGCGAT AAGTAGTGTGAATTGCAGAATTCAGTG AATCATCGAATCTTTGAACGCACATT GCGCCCCTCGGTATTCCTTGGGGCATGCCTG GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC GGTGCTTGTCCCGCCTCCCGCGCGGCGACTC GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC CCGCACCCGCCGGCCATGAGCGCAGCACAGT GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC ACCCCCCAAAATTGACCTCGGATCAGGTAGGATT GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG CAATAAGCGGAGGAACC

The patient was promptly started on antifungal therapy with Voriconazole 200 mg OD, the lesion had got completely healed and he is on regular maintenance haemodialysis.


 ~ Discussion Top


Fungal infections are an important consequence in renal transplantation and a cause of concern to patients and the physicians. Risk factors for fungal infections in transplant recipients include the use of large doses of corticosteroids, poor transplant function, recent or multiple rejection episodes, hyperglycemia, leukopenia and older age. [4],[5] Reduction in the number of epidermal antigen presenting Langerhans cells, corticosteroid induced thickening and delayed desquamation of the stratum corneum because of the treatment, have also been suggested to play a role in the development of these superficial or cutaneous fungal infections. [6],[7]

A study reported pityriasis versicolor as the most common cutaneous fungal infection in renal transplant recipients. [8] Although rare in clinical practice, melanised or dematiaceous fungi have become an important opportunistic pathogen, especially in immunocompromised patients.

Among the dematiaceous fungi belonging to the order Pleosporales, Alternaria spp, Bipolaris spp, Curvularia spp., and Exserohilum spp, have been commonly reported to cause cutaneous and subcutaneous infections. [9],[10],[11],[12] The fungus isolated in our case did not match with any of the above mentioned species. And this report being another case of cutaneous phaeohyphomycosis caused by a dematiaceous fungi belonging to Pleosporales, enlightens us to be aware of these unusual fungal infections especially in immunocompromised patients. Careful diagnosis and aggressive treatment play a vital role in the outcome of these infections.

 
 ~ References Top

1.
Badiee P, Alborzi A. Invasive fungal infections in renal transplant recipients. Exp Clin Transplant 2011;9:355-62.  Back to cited text no. 1
    
2.
Patel R, Paya CV. Infections in solid-organ transplant recipients. Clin Microbiol Rev 1997;10:86-124.  Back to cited text no. 2
    
3.
Revankar SG, Patterson JE, Sutton DA, Pullen R, Rinaldi MG. Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin Infect Dis 2002;34:467-76.  Back to cited text no. 3
    
4.
Bach MC, Adler JL, Breman J, P'eng FK, Sahyoun A, Schlesinger RM, et al. Influence of rejection therapy on fungal and nocardial infections in renal transplant recipients. Lancet 1973;1:180-4.  Back to cited text no. 4
[PUBMED]    
5.
Howard RJ, Simmons RL, Najarian JS. Fungal infections in renal transplant recipients. Ann Surg 1978;188:598-605.  Back to cited text no. 5
[PUBMED]    
6.
Virgili A, Zampino MR, La Malfa V, Strumia R, Bedani PL. Prevalence of superficial dermatomycosis in 73 renal transplant recipients. Dermatology 1999;199:31-4.  Back to cited text no. 6
    
7.
Strumia R, Perini L, Tarroni G, Fiocchi O, Gilli P. Skin lesions in kidney transplant recipients. Nephron 1992;62:137-41.  Back to cited text no. 7
    
8.
Güleç AT, Demirbilek M, Seçkin D, Can F, Saray Y, Sarifakioglu E, et al. Superficial fungal infections in 102 renal transplant recipients: A case-control study. J Am Acad Dermatol 2003;49:187-92.  Back to cited text no. 8
    
9.
Gené J, Azón-Masoliver A, Guarro J, Ballester F, Pujol I, Llovera M, et al. Cutaneous phaeohyphomycosis caused by Alternaria longipes in an immunosuppressed patient. J Clin Microbiol 1995;33:2774-6.  Back to cited text no. 9
    
10.
McGinnis MR, Rinaldi MG, Winn RE. Emerging agents of phaeohyphomycosis: Pathogenic species of Bipolaris and Exserohilum. J Clin Microbiol 1986;24:250-9.   Back to cited text no. 10
[PUBMED]    
11.
Yau YC, de Nanassy J, Summerbell RC, Matlow AG, Richardson SE. Fungal sternal wound infection due to Curvularia lunata in a neonate with congenital heart disease: Case report and review. Clin Infect Dis 1994;19:735-40.  Back to cited text no. 11
    
12.
Hsu MM, Lee JY. Cutaneous and subcutaneous phaeohyphomycosis caused by Exsero- hilum rostratum. J Am Acad Dermatol 1993;28:340-4.  Back to cited text no. 12
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04