Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 2209 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (721 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~ Subjects and Methods
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~ Acknowledgement
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed3193    
    Printed88    
    Emailed5    
    PDF Downloaded545    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2014  |  Volume : 32  |  Issue : 4  |  Page : 414-418
 

A possible alternative to the error prone modified Hodge test to correctly identify the carbapenemase producing Gram-negative bacteria


1 Department of Microbiology, Velammal Medical College Hospital and Research Institute, Anuppanadi, Madurai, India
2 Department of Microbiology, Christian Medical College, Vellore, Tamil Nadu, India

Date of Submission01-Oct-2013
Date of Acceptance12-Nov-2013
Date of Web Publication4-Oct-2014

Correspondence Address:
V Balaji
Department of Microbiology, Christian Medical College, Vellore, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.142258

Rights and Permissions

 ~ Abstract 

Context: The modified Hodge test (MHT) is widely used as a screening test for the detection of carbapenemases in Gram-negative bacteria. This test has several pitfalls in terms of validity and interpretation. Also the test has a very low sensitivity in detecting the New Delhi metallo-β-lactamase (NDM). Considering the degree of dissemination of the NDM and the growing pandemic of carbapenem resistance, a more accurate alternative test is needed at the earliest. Aims: The study intends to compare the performance of the MHT with the commercially available Neo-Sensitabs - Carbapenemases/Metallo-β-Lactamase (MBL) Confirmative Identification pack to find out whether the latter could be an efficient alternative to the former. Settings and Design: A total of 105 isolates of Klebsiella pneumoniae resistant to imipenem and meropenem, collected prospectively over a period of 2 years were included in the study. Subjects and Methods: The study isolates were tested with the MHT, the Neo-Sensitabs - Carbapenemases/MBL Confirmative Identification pack and polymerase chain reaction (PCR) for detecting the blaNDM-1 gene. Results: Among the 105 isolates, the MHT identified 100 isolates as carbapenemase producers. In the five isolates negative for the MHT, four were found to produce MBLs by the Neo-Sensitabs. The Neo-Sensitabs did not have any false negatives when compared against the PCR. Conclusions: The MHT can give false negative results, which lead to failure in detecting the carbapenemase producers. Also considering the other pitfalls of the MHT, the Neo-Sensitabs - Carbapenemases/MBL Confirmative Identification pack could be a more efficient alternative for detection of carbapenemase production in Gram-negative bacteria.


Keywords: Carbapenemase, Metallo beta lactamase, Modified Hodge test, NDM-1, Neo-Sensitabs


How to cite this article:
Jeremiah S S, Balaji V, Anandan S, Sahni R D. A possible alternative to the error prone modified Hodge test to correctly identify the carbapenemase producing Gram-negative bacteria. Indian J Med Microbiol 2014;32:414-8

How to cite this URL:
Jeremiah S S, Balaji V, Anandan S, Sahni R D. A possible alternative to the error prone modified Hodge test to correctly identify the carbapenemase producing Gram-negative bacteria. Indian J Med Microbiol [serial online] 2014 [cited 2019 Jun 15];32:414-8. Available from: http://www.ijmm.org/text.asp?2014/32/4/414/142258



 ~ Introduction Top


In the never ending war against bacteria using the available anti-microbial armamentarium, carbapenem resistance in Gram-negative organisms is the undoubtedly the biggest threat we are facing at present. Among the carbapenem-resistant organisms (CRO), carbapenemase production currently accounts to the most frequently encountered mechanism of resistance. The modified Hodge test (MHT) is the most widely used screening test for identifying carbapenemase producers. Although the MHT has gained the limelight in detection of carbapenemase production, it has several fallacies. The most recent Clinical and Laboratory Standards Institute (CLSI) guidelines mentions that the MHT has a very low sensitivity of only 11% in detecting the New Delhi metallo-β-lactamase (NDM). [1] As NDM-1 is the predominant cause of carbapenem resistance in India, the performance of the MHT in the country is questionable. Since the occurrence of the CRO over the past years have shown a steady upward trend, it is high time that we find a precise alternative to the erroneous MHT.

While state of the art sophisticated techniques such as spectrometry and molecular assays are being developed, their availability and feasibility in the routine laboratory setting is questionable. [2] In this context, the phenotypic tests have the advantage of being more practical even in a simple laboratory setting. Inhibitor-based disc diffusion assays using Ethylene di-amine tetra acetic acid (EDTA), boronic acid and cloxacillin are currently available for phenotypic confirmation of metallo-β-lactamases (MBL), Ambler class A carbapenemases including Klebsiella pneumoniae carbapenemases (KPC) and AmpC-β-lactamases, respectively. These tests have been reported to have a high degree of accuracy in detecting the corresponding carbapenemase. [3] The Rosco Neo-Sensitabs - Carbapenemases/MBL Confirmative Identification pack (RNS) employs the above principle and simultaneously detects the presence of the common carbapenemases. This study provides the comparative analysis of RNS versus the MHT.


 ~ Subjects and Methods Top


Bacterial isolates

Consecutive isolates of Klebsiella pneumoniae isolated from blood, sputum or urine samples; resistant to both imipenem and meropenem by the agar dilution technique were collected over a period of 2 years. This yielded 105 study isolates, which were subjected to MHT, RNS and polymerase chain reaction (PCR) detecting the blaNDM-1 gene.

Modified Hodge test

The MHT was performed as recommended by the CLSI guidelines. [1] A known strain of K. pneumoniae producing KPC, confirmed by PCR was used as the positive control (Provided by IMHA.inc, Chicago). The readings were taken twice, each by two different persons to avoid observer bias.

Neo-Sensitabs - Carbapenemases/Metallo-β-Lactamase Confirmative Identification pack

The test packs were obtained from Rosco Diagnostica, Denmark. The test is based on a novel diffusion method employing drug incorporated tablets of 9 mm diameter (Neo-Sensitabs) instead of the conventional 6 mm paper discs. The test is based on the principle that different types of β-lactamases can be inhibited in vitro using specific agents. Dipicolinic acid is a potent inhibitor of all classes of MBLs. KPC is inhibited by boronic acid and not by cloxacillin. AmpC-β-lactamases are inhibited by both boronic acid and cloxacillin. The pack comprises of a set of four tablets for each isolate tested. The contents of each type of tablet were; Meropenem 10 μg (MRP), Meropenem 10 μg + Boronic acid (MR+BO), Meropenem 10 μg + Cloxacillin (MR + CL) and Meropenem 10 μg + Dipicolinic acid (MR + DP). The packs were stored at 4°C and once opened; the tablets were transferred to a sterile  Petri dish More Details and kept at room temperature as suggested by the manufacturer. Preparation of inoculum, inoculation and incubation were carried out similar to routine disk diffusion testing. One isolate was tested per plate with one set of tablets (four tablets, one of each type). The tablets were placed on the surface of MHA using a sterile forceps. Quality control was done as per the manufacturer's recommendation using American Type Culture Collection (ATCC) 25922  Escherichia More Details coli, the strain of K. pneumoniae confirmed to produce KPC used in the MHT and the laboratory confirmed NDM-1 strain used in the PCR. After overnight incubation, the diameter of the zone of inhibition was noted around each tablet. No zone around any tablet corresponds to a 9 mm inhibition zone. Interpretation of the zone size surrounding the MRP tablet was based on the CLSI guidelines. [1] All the study isolates had a zone diameter of ≤19 mm around the MRP tablet, corresponding to meropenem resistance. The results are interpreted by comparing the inhibition zones around the different tablets [Table 1] and [Figure 1].
Table 1: Interpretation of Neo-Sensitabs - Carbapenemases/ Metallo-ƒÀ-Lactamase Confirmative Identification pack


Click here to view
Figure 1: Test organism showing a ≥ 5 mm increase in zone diameter around the MR+DP tablet, as compared with the MR tablet. This test isolated was interpreted as positive for MBL production

Click here to view


Polymerase chain reaction for blaNDM-1 gene

PCR was performed based on the methodology employed by Deshpande et al. [4]

In brief, DNA was extracted by the heat boil method. Primers targeting the blaNDM-1 gene used were; NDM Forward: 5'-GGGCAGTCGCTTCCAACGGT and NDM Reverse: 5'- GTAGTGCTCAGTGTCGGCAT (Sigma-Aldrich, Bengaluru). Amplification was done in VERITI 96 well Thermal Cycler, (Applied Bio systems, CA, USA) using the following parameters: Initial denaturation: 94°C for 3 min, 30 cycles of denaturation, annealing and extension at 94°C for 30 s, 60°C for 25 s and 72°C for 30 s, respectively, and final extension: 72°C for 3 min. The resultant amplicons for a positive reaction were 475 bp long visualised in 1.5% agarose gel under UV light using Gel Doc XR (Bio-Rad, Hercules, CA, USA) and Quantity one 1-D analysis Software (Bio-Rad, Hercules, CA, USA). A laboratory isolated strain of K. pneumoniae producing NDM-1, confirmed by PCR and sequencing of the blaNDM-1 gene was used as the positive control (GenBank accession number HQ171206, dated 18 September 2010) and ATCC 25922 E. coli was used as the negative control.


 ~ Results Top


The MHT identified 100 out of 105 isolates as carbapenemase producers. Of the 100 MHT positive isolates, the RNS identified 93 isolates to produce MBL. The remaining seven of the MHT positives were not found to produce either KPC or AmpC-β-lactamases by the RNS. Among the five MHT negative isolates, the RNS identified four isolates to produce MBL. PCR revealed that 88 of the 93 MHT positive MBL producers and two of the four MHT negative MBL producers (90 out of 105) harboured the blaNDM-1 gene. It was interesting to find that all the eight isolates tested negative for MBL by the RNS were also negative for the blaNDM-1 gene by PCR [Table 2].
Table 2: Characterisation of carbapenem resistance of the study isolates


Click here to view



 ~ Discussion Top


The MHT is widely being used as a phenotypic screening test for carbapenemase production among CRO. Initial studies on characterisation of mechanisms of carbapenem resistance, reported the MHT capable of detecting carbapenemase production with 100% sensitivity and specificity. [5] Subsequently the various pitfalls of the test were identified.

The most troublesome aspect for any screening test is the occurrence of false negatives. The MHT having a very low sensitivity of 11% while detecting NDM-1 is likely to produce a considerable proportion of false negatives. [1] This is especially applicable in the Indian subcontinent where NDM-1 is the most common cause of carbapenem resistance among the Enterobacteriaceae. [6] In the present study, the RNS identified four isolates as MBL producers out of five isolates, which were reported negative for carbapenemase by the MHT. These figures show that, 80% of the isolates deemed negative by the MHT were actually producing MBL. Among these four MHT negative MBL producers, two were confirmed to produce NDM-1 by the PCR. Considering the common occurrence of IMP and other non-NDM-1 MBLs, other two isolates probably produced MBLs other than NDM-1 [Table 2]. [7] The MHT can also produce false negative results when tested with non-fermenting Gram-negative bacteria such as Pseudomonas aeruginosa and Acinetobacter spp. [8] As these organisms are likely to disseminate in India, the results of MHT should be interpreted with caution while testing these organisms. [9]

The MHT can produce false positive results when tested on isolates producing excess of extended spectrum β-lactamases (ESBL). [10] In the present study, seven isolates with a positive MHT were not found to harbour the NDM-1, other MBLs, KPC or AmpC-β-lactamases [Table 2]. Considering the paucity of oxacillinase type of carbapenemases (OXA) and the abundance of ESBL among Enterobacteriacae in the country, these seven isolates most probably account to the false positives of the MHT. [11]

Among the other fallacies, the qualitative nature of the MHT causes subjective variations while interpreting the results. The results produced are not always binary, indeterminate results are a common occurrence, which can neither be considered positive, nor negative. [12] While testing P. aeruginosa, invalid results can be obtained due to killing of the E. coli lawn by the bacteriocins extruded by the test isolates. Similarly swarming can obscure the cloverleaf indentation causing invalid results when the MHT is employed for Proteus spp. [13]

To improve the sensitivity of the MHT for the detection of MBLs, some authors advocate the use of additional tests such as EDTA double disc synergy test or EDTA-carbapenem combined disc test. [8],[13] In spite of using additional tests, the RNS could be used as a single effective test. Other Studies also suggest further modifications of the MHT to enhance its sensitivity such as the use of a different indicator bacterial strain or the addition of zinc to the carbapenem disc. [12],[13] Nevertheless, the further modifications of the MHT do not eliminate the subjective nature of interpretation. The Carbapenemase Nordmann-Poirel (Carba NP) test was introduced as a rapid, inexpensive and a better alternative to the MHT. [14] However, it has been shown to have a low sensitivity and can produce false negative results when the isolate tested is mucoid or when the carbapenemase is produced in low levels. [15]

In this context, the RNS is proposed as an alternative test to supplant the MHT. Inhibitor-based assays for detection of MBL and KPC in formats such as epsilometer test, double disc approximation test and combination disc test are currently used as phenotypic confirmatory tests. Among these formats, the combination disc test is reported to perform superior, easier to carry out and interpret. [16] The RNS employs the combination principle using meropenem and three inhibitors for three types of carbapenemases. Boronic acid is a potent inhibitor of KPC and other types of serine carbapenemases except OXA. Studies have reported a very high sensitivity and specificity of this compound in detecting KPC. [17] EDTA and dipicolinate are potent chelators of divalent metal cations and are hence strong inhibitors of the zinc-dependent MBL. The AmpC-β-lactamases capable of hydrolysing carbapenems are rarely produced by Gram-negative bacteria including the Enterobacteriaceae. [18] These carbapenemases are inhibited by both boronic acid and cloxacillin. [19] The OXA type of carbapenemases are occasionally found in NFGNB and very rarely in the Enterobacteriaceae. [20] Till date, there are no compounds capable of inhibiting this class of carbapenemases. However, high level resistance to temocillin is an exclusive feature of OXA carbapenemases, not seen in other types of carbapenemases. Based on this property, the manufacturers have added a fifth tablet containing temocillin to the existing pack. This new pack is hence capable of identifying all types of carbapenemases at once. [21]

This study attempts to compare the performance of the novel RNS as a screening test for detection of carbapenemases over the conventional MHT. The MHT is capable of detecting only the presence or absence of carbapenemases while the RNS can detect and differentiate the types of carbapenemases. As it is a known fact that the MHT performs poorly in the detection of MBL, it would have been unjust to validate the performance of the RNS with reference to the MHT. Hence PCR was used as confirmatory tool to support the discrepancy between the MHT and the RNS. The RNS identified MBL in 80% of the isolates deemed negative by the MHT. The results of the RNS were concurrent with the NDM-1 PCR. The two isolates, which were MHT negative, MBL positive by RNS and NDM-1 PCR negative, could most probably be MBLs other than the NDM-1. It was interesting to find that all the isolates reported negative by the RNS were also negative by the PCR. This observation suggests that MBL detection by the RNS is in agreement with that of the PCR.

The results of the present study correlate well with other recent studies, which suggest the RNS as a reliable test in the detection of carbapenemases. [21] The RNS also has an added advantage that it can identify the class of carbapenemase produced and is also capable of differentiating the co-production of two different classes of carbapenemases by the same isolate. [22] However, the only demerit of the RNS appears to be its higher cost as it works out to be around five times more expensive than the MHT per isolate tested.


 ~ Conclusion Top


Among the characters of an ideal screening test, the most important character is that the test must be devoid of false negatives. In this context, the MHT falls short of being an ideal screening test as it is liable to miss out the MBL producers, especially the NDM-1. In the currently rampant dissemination of the NDM-1 in India and various parts of the world, failure to detect even a subset of these may result in a plethora of adverse consequences. Hence we conclude that in the present scenario, the RNS could be a more effective alternative to the MHT for detecting carbapenemase producing Gram-negative bacteria.


 ~ Acknowledgement Top


The authors thank the institutional review board of Christian Medical College, Vellore for approving the study (CMC IRB Min. No. 7031) and the institution's fluid research grant (Acc. No. 22 × 491) for making this study possible.

 
 ~ References Top

1.Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational supplement. M100-S23 ed. Wayne; 2013.  Back to cited text no. 1
    
2.Lee W, Chung HS, Lee Y, Yong D, Jeong SH, Lee K, et al. Comparison of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry assay with conventional methods for detection of IMP-6, VIM-2, NDM-1, SIM-1, KPC-1, OXA-23, and OXA-51 carbapenemase-producing Acinetobacter spp., Pseudomonas aeruginosa, and Klebsiella pneumoniae. Diagn Microbiol Infect Dis 2013;77:227-30.  Back to cited text no. 2
    
3.Nordmann P, Gniadkowski M, Giske CG, Poirel L, Woodford N, Miriagou V, et al. Identification and screening of carbapenemase-producing Enterobacteriaceae. Clin Microbiol Infect 2012;18:432-8.  Back to cited text no. 3
[PUBMED]    
4.Deshpande P, Rodrigues C, Shetty A, Kapadia F, Hedge A, Soman R. New Delhi Metallo-beta lactamase (NDM-1) in Enterobacteriaceae: Treatment options with carbapenems compromised. J Assoc Physicians India 2010;58:147-9.  Back to cited text no. 4
    
5.Anderson KF, Lonsway DR, Rasheed JK, Biddle J, Jensen B, McDougal LK, et al. Evaluation of methods to identify the Klebsiella pneumoniae carbapenemase in Enterobacteriaceae. J Clin Microbiol 2007;45:2723-5.  Back to cited text no. 5
    
6.Lascols C, Hackel M, Marshall SH, Hujer AM, Bouchillon S, Badal R, et al. Increasing prevalence and dissemination of NDM-1 metallo-{beta}-lactamase in India: Data from the SMART study (2009). J Antimicrob Chemother 2011;66:1992-7.  Back to cited text no. 6
    
7.Azim A, Dwivedi M, Rao PB, Baronia AK, Singh RK, Prasad KN, et al. Epidemiology of bacterial colonization at intensive care unit admission with emphasis on extended-spectrum beta-lactamase- and metallo-beta-lactamase-producing Gram-negative bacteria: An Indian experience. J Med Microbiol 2010;59:955-60.  Back to cited text no. 7
    
8.John S, Balagurunathan R. Metallo beta lactamase producing Pseudomonas aeruginosa and Acinetobacter baumannii. Indian J Med Microbiol 2011;29:302-4.  Back to cited text no. 8
[PUBMED]  Medknow Journal  
9.Khajuria A, Praharaj AK, Kumar M, Grover N. Emergence of NDM-1 in the Clinical Isolates of Pseudomonas aeruginosa in India. J Clin Diagn Res 2013;7:1328-31.  Back to cited text no. 9
    
10.Wang P, Chen S, Guo Y, Xiong Z, Hu F, Zhu D, et al. Occurrence of false positive results for the detection of carbapenemases in carbapenemase-negative Escherichia coli and Klebsiella pneumoniae isolates. PLoS One 2011;6:e26356.  Back to cited text no. 10
    
11.Oberoi L, Singh N, Sharma P, Aggarwal A. ESBL, MBL and Ampc β Lactamases Producing Superbugs-Havoc in the Intensive Care Units of Punjab India. J Clin Diagn Res 2013;7:70-3.  Back to cited text no. 11
    
12.Pasteran F, Veliz O, Rapoport M, Guerriero L, Corso A. Sensitive and specific modified Hodge test for KPC and metallo-beta-lactamase detection in Pseudomonas aeruginosa by use of a novel indicator strain, Klebsiella pneumoniae ATCC 700603. J Clin Microbiol 2011;49:4301-3.  Back to cited text no. 12
    
13.Rai S, Manchanda V, Singh NP, Kaur IR. Zinc-dependent carbapenemases in clinical isolates of family Enterobacteriaceae. Indian J Med Microbiol 2011;29:275-9.  Back to cited text no. 13
[PUBMED]  Medknow Journal  
14.Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2012;18:1503-7.  Back to cited text no. 14
    
15.Tijet N, Boyd D, Patel SN, Mulvey MR, Melano RG. Evaluation of the Carba NP test for rapid detection of carbapenemase-producing Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrob. Agents Chemother 2013;57:4578-80. Available from: http://aac.asm.org/content/early/2013/06/25/AAC.00878-13 [Last cited on 2013 Sep 26].  Back to cited text no. 15
    
16.Behera B, Mathur P, Das A, Kapil A, Sharma V. An evaluation of four different phenotypic techniques for detection of metallo-beta-lactamase producing Pseudomonas aeruginosa. Indian J Med Microbiol 2008;26:233-7.  Back to cited text no. 16
[PUBMED]  Medknow Journal  
17.Nicola FG, Nievas J, Smayevsky J. Evaluation of phenotypic methods for the detection of KPC carbapenemases in Klebsiella pneumoniae. Rev Argent Microbiol 2012;44:290-302.  Back to cited text no. 17
    
18.Dahyot S, Broutin I, de Champs C, Guillon H, Mammeri H. Contribution of asparagine 346 residue to the carbapenemase activity of CMY-2 β-lactamase. FEMS Microbiol Lett 2013;345:147-53.  Back to cited text no. 18
    
19.Mirelis B, Rivera A, Miró E, Mesa RJ, Navarro F, Coll P. A simple phenotypic method for differentiation between acquired and chromosomal AmpC beta-lactamases in Escherichia coli. Enferm Infecc Microbiol Clin 2006;24:370-2.  Back to cited text no. 19
    
20.Niranjan DK, Singh NP, Manchanda V, Rai S, Kaur IR. Multiple carbapenem hydrolyzing genes in clinical isolates of Acinetobacter baumannii. Indian J Med Microbiol 2013;31:237-41.  Back to cited text no. 20
[PUBMED]  Medknow Journal  
21.van Dijk K, Voets GM, Scharringa J, Voskuil S, Fluit AC, Rottier WC, et al. A disc diffusion assay for detection of class A, B and OXA-48 carbapenemases in Enterobacteriaceae using phenyl boronic acid, dipicolinic acid and temocillin. Clin Microbiol Infect 2013.  Back to cited text no. 21
    
22.Miriagou V, Tzelepi E, Kotsakis SD, Daikos GL, Bou Casals J, Tzouvelekis LS. Combined disc methods for the detection of KPC- and/or VIM-positive Klebsiella pneumoniae: Improving reliability for the double carbapenemase producers. Clin Microbiol Infect 2013;19:E412-5.  Back to cited text no. 22
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04