Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 2216 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (623 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Acknowledgements
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed2289    
    Printed92    
    Emailed3    
    PDF Downloaded145    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2014  |  Volume : 32  |  Issue : 3  |  Page : 251-255
 

Detection of Hepatitis C virus RNA in peripheral blood mononuclear cells of patients with abnormal alanine transaminase in Ahvaz


1 Health Research Institute, Infectious and Tropical Disease Research Center; Department of Medical Virology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences; Research Institute for Infectious Diseases of Digestive System, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2 Department of virology, Urumia University of Medical Science, Urumia, Iran
3 Department of Medical Virology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
4 Communicable Disease control, Iranian Ministry of Health and education, Tehran, Iran
5 Faculty of Veterinary Science, Tehran University, Tehran, Iran
6 Department of Gastroenterology and Hepatology, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

Date of Submission25-Nov-2012
Date of Acceptance03-Dec-2013
Date of Web Publication10-Jul-2014

Correspondence Address:
M Makvandi
Health Research Institute, Infectious and Tropical Disease Research Center; Department of Medical Virology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences; Research Institute for Infectious Diseases of Digestive System, Ahvaz Jundishapur University of Medical Sciences, Ahvaz
Iran
Login to access the Email id

Source of Support: PGIMER research grant,, Conflict of Interest: None


DOI: 10.4103/0255-0857.136553

Rights and Permissions

 ~ Abstract 

Purpose: Hepatitis C virus (HCV) is an important agent for chronic and acute hepatitis. Occult hepatitis C remains a major health problem worldwide. Patients with chronic occult HCV may progress to cirrhosis and hepatocellular carcinoma. The aim of this study was to determine prevalence of occult hepatitis C by IS-PCR-ISH (in situ PCR in situ hybridisation) in the patients with abnormal ALT. Materials and Methods: The blood samples were taken from 53 patients including 17 females (32.1%) and 36 (67.9%) males who had abnormal alanine transaminase (ALT) for more than 1 year. The mean ALT and aspartate transaminase (AST) level were 41.02 ± 9.3 and 24.17 ± 7.3, respectively. The patients' age were between 4 and 70-years old with mean age 38 ± 13. All the patients were negative for HCV antibody, HCV RNA and HBs Ag. The peripheral blood mononuclear cells (PBMC) were separated with ficoll gradient from each blood sample, then the cells were fixed on slides by cold acetone and followed by IS-PCR-ISH for HCV RNA detection. Results: Seventeen (32%) patients including 6 (11.3%) females and 11 (20.7%) males showed positive results for HCV RNA by in situ-PCR in situ hybridisation. Ten (18.8%) positive cases were between 20 and 40-years old and 6 (11.3%) positive patients were between 40 and 60 years old. Ten (19.6%) patients who were positive for IS-PCR-ISH also had positive anti-HBc IgG and 7 (13.2%) patients were negative for HBc-IgG. Conclusion: In the present study high rate of 32% occult hepatitis C were found among the patients with elevated ALT.


Keywords: Alanine transaminase, Hepatitis C, polymerase chain reaction


How to cite this article:
Makvandi M, Khalafkhany D, Rasti M, Neisi N, Omidvarinia A, Mirghaed A T, Masjedizadeh A, Shyesteh A A. Detection of Hepatitis C virus RNA in peripheral blood mononuclear cells of patients with abnormal alanine transaminase in Ahvaz. Indian J Med Microbiol 2014;32:251-5

How to cite this URL:
Makvandi M, Khalafkhany D, Rasti M, Neisi N, Omidvarinia A, Mirghaed A T, Masjedizadeh A, Shyesteh A A. Detection of Hepatitis C virus RNA in peripheral blood mononuclear cells of patients with abnormal alanine transaminase in Ahvaz. Indian J Med Microbiol [serial online] 2014 [cited 2020 Apr 7];32:251-5. Available from: http://www.ijmm.org/text.asp?2014/32/3/251/136553



 ~ Introduction Top


Hepatitis C virus (HCV) is an enveloped virus with a single-stranded positive sense 9.6-kilobase RNA nucleic acid. HCV classified in the family Flaviviridea and genus Hepacivirus The major organ that can support HCV replication is liver; however, in recent years replicating form of HCV was found in the peripheral blood mononuclear cells (PBMC). [1],[2],[3] The lack of an efficient vaccine against HCV makes it a global health problem. [2] HCV is an important agent for acute and chronic hepatitis that approximately 180 million people get chronically infected with it and some of them lead to hepatocellular carcinoma. [3] Presence of HCV RNA in hepatocyte and peripheral blood mononuclear in the absence of detectable HCV RNA in the serum specimen defined as occult hepatitis C infection. [1],[3] Patient with occult hepatitis C infection were divided in two types. Type A patients who were seronegative for anti-HCV antibody and the type B are the patients chronically infected who have sustained virological response to therapy and were seropositive. [3] Detection of virus in biopsy of liver is the gold standard test for diagnosis of occult HCV infection but it is an invasive method [1] Lymphotropism of HCV was well known thus PBMCs are the other source of virus during HCV infection and could be used for HCV RNA detection. [1],[4] Based on other reports, the rate of positive mononuclear cells for HCV RNA in patients with persistent elevated ALT level were found to be 10-50% [1],[5],[6] The aim of present study is to evaluate the rate of occult HCV infection in patients with abnormal ALT.


 ~ Materials and Methods Top


In this study, we have collected 53 blood samples from patients including 17 females (32%) and 36 (68%) males [Table 1] who had abnormal ALT persistent for more than 1 year. All of the patients were registered in Danesh laboratory in Ahvaz city, Iran during 2011-2012. Ethic consent was taken from all the patients.
Table 1: Gender of patients


Click here to view


All the patients had abnormal ALT and AST with mean level of 41.02 ± 9.3 and 24.17 ± 7.3, respectively [Table 2]. The patients were divided in three age groups [Table 3]. The mean age of patients was 38.8 ± 13.77 with minimum 4 and maximum 70-years old. Patients with fatty liver disease, drug users, autoimmune hepatitis, genetic disease and metabolic disorder were excluded [Table 3]. The ficoll gradient (Stem Cell Technologies, USA) was used to separate PBMC. [7] According to the instruction, briefly 3 ml of whole blood diluted with 6-ml PBS containing 2% foetal bovine serum and then carefully 3 ml Ficoll Hypaque was added followed by centrifugation at 1200x g for 20 minutes at room temperature. The whitish layer was separated and washed three times with 1X hanks balance solution followed by final centrifugation at x2000 g for 20 minutes before the pellet was collected. The pellet was reconstituted to final concentration of 500000 cells/ml. About 100 μl of cells was smeared on glass slides and covered with cold acetone (-20) to fix cells. The PBMC of the 10 patients whom were positive for HCV antibody and RT-PCR used as positive control. The PBMC of the 10 patients whom had normal ALT, AST and were negative for HCV antibody and RT-PCR were used as negative control.
Table 2: Patients' characteristics


Click here to view
Table 3: Age group insitu PCR cross - tabulation


Click here to view


All the patient sera were tested for Anti HCV Ab, HBsAg, HEV IgM and HBc IgG using ELISA kit (Diapro, Italy), according to manufacturer. The samples which were negative for HCV antibody, HCV RNA, HBs Ag and HEV IgM, entered this study.

RNA extraction and cDNA synthesis

The total RNA was extracted from serum samples using a high pure viral RNA kit (Roach, USA). The cDNA was prepared using cDNA synthesis kit (Thermo science, USA). Briefly, 6 μl of each sample was mixed with 1 μl random hexamer and 5 μl DEPC water was added to make mixture (A). The solutions were incubated at 65˚C for 5 minutes and immediately chilled on ice. To make mixture (B), 4 μl of ×5 reaction buffer was mixed with 1-μl RNase inhibitor (20 unit), 2-μl dNTP (1 mM) and 2 μl reverse transcriptase (40 unit). Mixtures A and B were mixed together and incubated at 37°C for 60 minutes and finally the reaction was terminated by heating at 70°C for 5 minutes.

Nested RT-PCR

The nested RT-PCR was done for detection HCV RNA in serum samples was done with following primers from 5' untranslated region (UTR) of Hepatitis C virus genome:

BKP-7,-CACTCCCCTGTGAGGAACTACTGTC (nucleotides 38 to 62) as the outer sense,

BKP-8,ATGGTGCACGGTCTACGAGACCTCC (nucleotides 319 to 343) as the outer anti-sense;

BKP-9,TTCACGCAGAAAGCGTCTAGCCATG (nucleotides 63 to 87) as the inner sense;

BKP-10,GCGCACTCGCAAGCACCCTATCAGG (nucleotides 292 to 314) as the inner anti-sense primer.

For first round: 2.5 μl 10x PCR buffer (Roach) was mixed with 0.5-μl dNTP mix (0.2 mM), 0.25 μl of BKP-7 and BKP-8 primers (0.5 μM), 0.2 μl (1 unit) Taq polymerase, 5 μl of template and water up to 25 μl. The PCR was performed over 25 cycles followed by 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec with final extension at 72°C for 10 minutes. The second round was carried out like the first round with the inner set of primers (BKP-9 and BKP-10) with the same PCR mixture and programme. The first PCR product was 306 bp for the outer set and the second product was 254 bp for the inner set. [7]

Is-PCR-ISH In situ-PCR-In situ Hybridisation)

The IS-PCR- ISH method was carried out as described previously [8],[9] with a little modification. Briefly, the fixed mononuclear cells on slides were dehydrated through graded ethanol (70%, 80%, 90% and 100%) for 10 minutes, and then covered with RNase-free water for 5 minutes. Slides then were covered with 0.02 M HCL, washed in PBS and then covered with PBS/Triton X-100 for 3 min. The mononuclear membrane was permeabilised by incubation with 2.5 μg/ml pepsin in 0.01 M HCl at 37°C for 30 minutes. The slides were washed in PBS/glycine, and then dehydrated through graded alcohols for 10 min. Gene frames were attached around the sections and RNase-free DNase solution (100 U/ml) was added and incubated overnight at 37°C. Then the slides were incubated at 94ºC for 2 minutes to inactivate DNase. The gene frames were removed and slides were washed in water and then in 100% ethanol. New gene frames were attached and cDNA was synthesised as previously described. Gene frames were removed and the slides washed with distilled water, PBS and dehydrated through graded ethanol. New gene frame was attached and the nested PCR was done as follow: for the first round a 25-μl reaction was prepared consisting of 2.5-μl 10x PCR buffer, 2 μl (4 mM) mgcl 2, 0.5 μl (0.2 mM) dNTP, 0.25 μl each primers, 0.2 μl taq polymerase (1 unit) and DPEC water up to 25 μl. The slides were placed in in situ PCR thermal cycler (Techne TC-512, UK) and programmed as previously described. After amplification, the sections were washed in PBS, water and dehydrated through graded alcohol over 10 min and air dried. The second round was done like to first round with the inner set of primers (BKP-9 and BKP-10) and same PCR mixture and program. The gene frames were removed and the slides were washed in PBS, distilled water and dehydrated through graded alcohol over 10 min and air dried. In situ hybridisation was performed using a novel 65-bp biotin-labeled probe, BKP-probe [5'CCACG AAAGGACCCGGTCATCCTGGCAATTCCGGT GTATCACCGGTTCCGCAGACCACTATGGC]. A new gene frame was attached and 25-μl hybridisation buffer containing 200 ng/ml of BKP probe was added to the sections. The slides were placed in the thermo cycler to run a denaturing cycle of 94°C and hybridisation was carried out overnight at 37°C. The slides were washed with ×2 SSC solution (saline-sodium citrate). The slides were covered with Streptavidin Alkaline Phosphatase conjugate diluted at 1.5:1000 in buffer 1 and incubated at room temperature for 15 min. Slides were washed in buffer A (0.5 M Triton x-100, 2mM MgCl 2 , 0.1 M NaCl, 0.1 M Tris Hcl = 7.5) and then in buffer B (0.1 M Tris Hcl PH: 9.5, 1 M NaCl, 50 mM MgCl 2 ). The slides were covered with dye solution NBT-BCIP (Roach) and incubated in 37°C for about 1 h. Finally, the slides were washed in PBS and water, air dried and microscopy observation was prepared.

Statistic

Data (ALT, AST, age) are expressed as the mean ± standard deviation, or n (%) as appropriate. SPSS version 17 and independent sample T test was used for data analysis to find out any significant relationship between the two groups of patients who were positive or negative by IS-PCR-ISH. The P < 0.05 is significant.


 ~ Results Top


Out of 53 patients, 17 (32%) including 6 (11.3%) female and 11 (20.7%) male showed positive HCV RNA by IS-PCR-ISH, 36 (68%) showed negative result [Figure 1]. Most positive cases were between 20 and 40 years (10 patients) and 40 and 60 years (6 patients). Ten (18.8%) patients who were positive HCV by IS-PCR-ISH were also positive for anti-HBc IgG. The means of ALT and AST were higher in patients with occult HCV infection compared to patients with negative HCV infection. The distribution of occult HCV within the age groups was not found significant (P > 0.05) [Table 1]. All the patients were negative for HCV antibody, HCV RNA, HBs Ag, HEV IgM and HAV IgM.
Figure 1: (a) Picture of positive control, a patients with positive HCV Antibody and HCV PCR in serum and abnormal ALT (b) Negative control with negative HCV Antibody and negative PCR in serum and normal ALT. (c and d) Two patients with positive result ( HCV RNA in peripheral blood mononuclear cells ) post staining with Giemsa

Click here to view



 ~ Discussion Top


The occult hepatitis C, as a new concern of public health worldwide, occurrs in two different forms, anti-HCV Ab and HCV RNA-negative patients with abnormal ALT or anti-HCV Ab-positive and HCV RNA-negative patients with normal ALT level. Occult HCV is responsible for recurrent hepatitis C infection in patients who were subjected to liver transplantation. [10],[11] For diagnosis of occult HCV, detection and localisation of HCV in liver tissue is a gold standard for diagnostic purposes and clinical management of HCV-infected patients. [10],[11],[12] However, invasive aspects of liver biopsy for patients, make it an hard and unpractical method. In other studies, it is mentioned that PBMCs could be used for HCV RNA detection by IS-PCR-ISH.[10],[13] In other report, HCV RNA was detectable in PBMC of 70% of patients, positive for HCV RNA in their liver biopsies. [14] In this study, acetone was used for cell fixation on glass slide instead of formaldehyde which have negative effect on the fixed cells. [15],[16] We also used pepsin enzyme to facilitate permeabilising cell membrane to permit PCR components enter to the cytoplasm that is a critical stage for IS-PCR-ISH. Pepsin is a better option than protease K for permeabilisation process and do not need heat for inactivation process. [8] RNase-free DNase was used to remove cellular DNA to increase specificity and decrease the chance of non-specific amplification and false positive result. In our study, 17 (32%) patients had positive result for HCV RNA by IS-PCR-ISH and recognised as occult hepatitis C patients, our result is close to other reports (10-50%) in patients with persistent elevated ALT level. [1],[5],[6],[13],[17],[18] 10 (18.8%) patients were positive anti-HBc IgG which may indicate dual infection. HCV coinfection with hepatitis B virus in southeast-Asia and Mediterranean countries is common. [19],[20] Some reports suggest that in dual infection with HCV and HBV, HCV can inhibit the replication of Hepatitis B virus. [19],[20] Sagnelli reported that presence of anti-HCV and anti-HBc Antibody in patients without HBsAg and anti-HBs, might be duel HBV and HCV infection. [21] Based on these facts in our study, those patients with occult hepatitis C infection whom their sera were negative for HBsAg, might have occult hepatitis B infection. However, dual infection with Hepatitis B and C virus and their interaction is a complex concept and requires further investigation.


 ~ Acknowledgements Top


This study was done as a research project with 88116 registration number in Health Research Institute, Infectious and Tropical Disease Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran . Our great appreciate goes to Mr. Hamidifard to provide positive control for this study. This study was supported by infectious and Tropical disease research center in Ahvaz university of medical science.

 
 ~ References Top

1.Welker MW, Zeuzem S. Occult hepatitis C: How convincing are the current data?. Hepatology 2009;49:665-75.  Back to cited text no. 1
    
2.Alavian SM. Control of hepatitis C in Iran: Vision and missions. Hepat Mon 2007;7:57-8.  Back to cited text no. 2
    
3.Crax A, Laffi G, Zignego AL. Hepatitis C virus infection: A systemic disease. Mol Aspects Med 2008;29:85-95.  Back to cited text no. 3
    
4.Zignego AL, Giannini C, Monti M, Gragnani L. Hepatitis C virus lymphotropism: Lessons from a decade of studies. Dig Liver Dis 2007;39:S38-45.  Back to cited text no. 4
    
5.Pinarbasi B, Bozaci M, Akyuz F, Badur S, Demir K, Besisik F, et al. The presence of HCVRNA in the peripheral blood mononuclear cells of the individuals with isolated anti HCV positivity: Is HCV hiding out? J Hepatol 2008;48:S222.  Back to cited text no. 5
    
6.Castillo I, Rodriguez-Inigo E, Lopez-Alcorocho JM, Pardo M, Bartolome J, Carreno V. Hepatitis C virus replicates in the liver of patients who have a sustained response to antiviral treatment. Clin Infect Dis 2006;43:1277-83.  Back to cited text no. 6
    
7.Howell CL, Miller MJ, Martin WJ. Comparison of rates of virus isolation from leukocyte populations separated from blood by conventional and Ficoll-Paque/Macrodex methods. J Clin Microbiol 1979;10:533-7.  Back to cited text no. 7
[PUBMED]    
8.Alzahrani AJ, Vallely PJ, McMahon RF. Development of a novel nested in situ PCR-ISH method for detection of hepatitis C virus RNA in liver tissue. J Virol Methods 2002;99:53-61.  Back to cited text no. 8
    
9.Pellestor F. Methods in molecular biology. In: PRINS and in situ PCR Protocols. 2 nd ed. Totowa: Humana Press; 2006. p. 61-78.  Back to cited text no. 9
    
10.Carreño V. Occult hepatitis C virus infection: A new form of hepatitis C. World J Gastroenterol 2006;12:6922-5.  Back to cited text no. 10
    
11.Feray C, Samuel D, Thiers V, Gigou M, Pichon F, Bismuth A, et al. Reinfection of liver graft by hepatitis C virus after liver transplantation. J Clin Invest 1992;89:1361-5.  Back to cited text no. 11
    
12.Laskus T, Radkowski M, Wilkinson J, Vargas H, Rakela J. The origin of hepatitis C virusreinfecting transplanted livers: Serum-derived versus peripheral blood mononuclear cell-derived virus. J Infect Dis 2002;185:417-21.  Back to cited text no. 12
    
13.Muratori L, Giostra F, Cataleta M, Francesconi R, Balardini G, Cassani F, et al. Testing for hepatitis C virus sequences in peripheral blood mononuclear cells of patients with chronic hepatitis C in the absence of serum hepatitis C virus RNA. Liver 1994;14:124-8.  Back to cited text no. 13
    
14.Castillo IM, Pardo J, Bartolome N, Ortiz-Movilla E, Rodriguez-In˜igo E, de Lucas S, et al. Occult hepatitis C virus infection in patients in whom the etiology of persistently abnormal results of liver function test is unknown. J Infect Dis 2004;189:7-14.  Back to cited text no. 14
    
15.Foss RD, Guha-Thakurta N, Conran RM, Gutman P. Effects of fixative and fixation time on the extraction and polymerase chain reaction amplification of RNA from paraffin-embedded tissue. Comparison of two housekeeping gene mRNA controls. Diagn Mol Pathol 1994;3:148-55.  Back to cited text no. 15
    
16.Guerrero RB, Batts KP, Brandhagen DJ, Germer JJ, Perez RG, Persing DH. Effects of formalin fixation and prolonged block storage on detection of hepatitis C virus RNA in liver tissue. Diagn Mol Pathol 1997;6:277-81.  Back to cited text no. 16
    
17.Bettinger D, Mougin C, Fouqué B, Kantelip B, Miguet JP, Lab M. Direct in situ reverse transecriptase-linked polymerase chain reaction with biotinylated primers for the detection of hepatitis C virus RNA in liver biopsies. J Clin Virol 1999;12:233-41.  Back to cited text no. 17
    
18.Barril G, Castillo I, Arenas MD, Espinosa M, Garcia-Valdecasas J, Garcia-Fernández N, et al. Occult hepatitis C virus infection among hemodialysis patients. J Am Soc Nephrol 2008;19:2288-92.  Back to cited text no. 18
    
19.Zhihua L, Jinlin H. Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) dual infection. Int J Med Sci 2006;3:57-62.  Back to cited text no. 19
    
20.Chu CJ, Lee SD. Hepatitis B virus/hepatitis C virus Co infection: Epidemiology, clinical features, viral intractions and treatment. J Gastroentrol Hepatol 2008;23:512-20.  Back to cited text no. 20
    
21.Sagnelli E, Coppola N, Scolastico C, Filippini P, Santantonio T, Stroffolini T, et al. Virologic and clinical expressions of reciprocal inhibitory effect of hepatitis B, C, and delta viruses in patients with chronic hepatitis. Hepatology 2000;32:1106-10.  Back to cited text no. 21
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
Print this article  Email this article
 

    

© 2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04