Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1175 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (561 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Acknowledgements
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed2645    
    Printed71    
    Emailed4    
    PDF Downloaded243    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
BRIEF COMMUNICATION
Year : 2014  |  Volume : 32  |  Issue : 2  |  Page : 175-178
 

Prevalence of adhesive genes among uropathogenic Escherichia coli strains isolated from patients with urinary tract infection in Mangalore


1 Department of Microbiology, K. S. Hegde Medical Academy, NITTE University, Derlakatte, Mangalore, Karnataka, India
2 Harvest and Post Harvest Technology Division, Central Institute of Fisheries Education, Mumbai, Maharashtra, India
3 Department of Fishery Microbiology, Karnataka Veterinary, Animal and Fisheries Sciences University, College of Fisheries, Mangalore, Karnataka, India
4 Department of Pediatrics, Wake Forest University School of Medicine, Winston Salem, North Carolina, USA

Date of Submission10-Aug-2013
Date of Acceptance07-Dec-2013
Date of Web Publication2-Apr-2014

Correspondence Address:
A V Shetty
Department of Microbiology, K. S. Hegde Medical Academy, NITTE University, Derlakatte, Mangalore, Karnataka, India

Login to access the Email id

Source of Support: UNESCO MIRCEN for Biotechnology, Department of Microbiology, College of Fisheries, Mangalore,, Conflict of Interest: None


DOI: 10.4103/0255-0857.129812

Rights and Permissions

 ~ Abstract 

The study was carried out to detect the adhesive genes pap (pyelonephritis associated pili), sfa (S fimbrial adhesin) and afa (afimbrial adhesin) from Escherichia coli strains isolated in patients diagnosed with urinary tract infection (UTI). A total of 23% of the isolates were positive for pap, sfa and afa genes with a prevalence of 60.87% (14/23), 39.1% (9/23) and 39.1% (9/23), respectively. Prevalence of multiple adhesive genes was 8.7% (2/23) for pap and afa, 30.43% (7/23) for pap and sfa. Significant numbers of isolates were positive for Congo red binding (80%) and haemolysin production 60%. The prevalence of multiple adhesive genes indicate the potential to adhere and subsequently cause a systemic infection among UTI patients.


Keywords: Adhesive genes, congo red binding, Escherichia. coli, haemolysin, urinary tract infection, UPEC


How to cite this article:
Shetty A V, Kumar S H, Shekar M, Shetty A K, Karunasagar I, Karunasagar I. Prevalence of adhesive genes among uropathogenic Escherichia coli strains isolated from patients with urinary tract infection in Mangalore. Indian J Med Microbiol 2014;32:175-8

How to cite this URL:
Shetty A V, Kumar S H, Shekar M, Shetty A K, Karunasagar I, Karunasagar I. Prevalence of adhesive genes among uropathogenic Escherichia coli strains isolated from patients with urinary tract infection in Mangalore. Indian J Med Microbiol [serial online] 2014 [cited 2019 Sep 23];32:175-8. Available from: http://www.ijmm.org/text.asp?2014/32/2/175/129812



 ~ Introduction Top


Uropathogenic Escherichia coli UPEC strains are often marked by the presence of special virulence determinants. UPEC carry chromosomal gene clusters on 'pathogenicity islands', which encode adhesins such as P pili, S pili and afimbrial adhesins and other virulence genes. [1]

E. coli P-fimbriae are mannose-resistant haemagglutinins predominant at the cell surface and associated with colonisation of upper urinary tract and binding to the kidney vascular endothelium causing pyelonephritis. [2] S-fimbrial adhesins are frequently expressed in E. coli strains involved in extraintestinal infections. This adhesin family consists of S-fimbriae (sfa), F1C-fimbriae Foc and S/F1C Sfa. [3]

Pathogenic E. coli strains associated with intestinal and extraintestinal infections in humans and animals are reported to express operons of the afa family. [4] The afimbrial adhesin is a mannose resistant, P-independent, X-binding adhesin, encoded by the afa-1 operon mediating the specific binding to uroepithelial cells and human erythrocyte-receptors. The afa operon show a high degree of heterogeneity among uropathogenic E. coli isolates with certain subtypes being predominantly present in pyelonephritis as well as in other urinary tract infections UTIs. [5]


 ~ Materials and Methods Top


Bacterial isolates

A total of 150 urine samples were collected in outpatients from clinics and inpatients of few hospitals in Mangalore. Isolation and identification of E. coli was done by standard biochemical tests and maintained in glycerol broth preserved at -80ºC for further studies.

Detection of pap, sfa and afa genes by PCR

Primers used to detect pap gene were, pap1 (5′GACGGCTGTACTGCAGGGTGTGGCG3′) and pap2 (5′ ATATCCTTTCTGCAGGGATGCAATA3′), sfa gene were, sfa1 (5′CTCCGGAGAACTGGGTGCATCTTAC3′) and sfa2 (5′ CGGAGGAGTAATTACAAACCTGGCA3′), afa gene were, afa1 (5′GCTGGGCAGCAAACTGATAACTCTC3′) and afa2 (5′ CATCAAGCTGTTTGTTCGTCCGCCG3′) and PCR was carried out as described by Blanco et al. [6] The respective E. coli strains (U-30 for pap gene, U-65 for sfa and U-46 for afa gene, [Figure 1]a-c] previously confirmed by polymerase chain reaction (PCR) in our laboratory were used as PCR positive controls. Before selecting these strains as positive controls, one of the strains was reconfirmed by PCR amplification and nucleotide sequencing using the same specific primers. The primers afa1 and afa2 were used to amplify a 750 bp portion of afa gene of uropathogenic E. coli. The PCR product derived from the strain u-46 was purified using Qiagen PCR purification kit (Qiagen USA) and sequenced using the same primers at Bioserve Bitotechnologies, India. The sequence was subjected to standard nucleotide-nucleotide BLAST of National Centre for Biotechnology Information NCBI. The BLAST results revealed 97% similarity with the afa gene sequence in the GenBank under the accession number X76688.
Figure 1: (a) Detection of pap gene of Uropathogenic E. coli by PCR. Lane M: Gene Ruler Plus 100 bp DNA ladder (Fermentas), Lane 1: Reference strain U-30, Lane 2: Negative control strain, Lanes 3-7: Uropathogenic E. coli isolates (b) Detection of sfa gene of Uropathogenic E. coli by PCR. Lane M: 100bp DNA marker, Lane 1: Reference strain U-65, Lane 2: Negative control strain, Lanes 3-5: Uropathogenic E. coli isolates (c) ropathogenic E. coli isolates showing afa gene by PCR. Lane M: 100bp DNA marker, Lane 1: Reference strain U-30, Lane 2: Negative control strain, Lanes 3 and 4: Uropathogenic E. coli isolates

Click here to view


Haemolysin production and Congo red binding test

The production of haemolysin by E. coli strains was confirmed by the complete haemolysis around the colonies grown on Sheep blood agar. Congo red binding assay was performed as described by Berkhoff and Vinal. [7]


 ~ Results Top


Of the 150 urine samples tested, 100 samples were positive for E. coli UTI. Twenty-three isolates among the 100 positive, possessed adhesive genes. The prevalence of pap gene was highest 60.87% (14/23) followed by sfa and afa 39.1% (9/23) genes each [Table 1].

Some isolates harboured the adhesive genes either singly or in combination. Among the 23 isolates, the prevalence of gene coding individually for fimbrial adhesions, pap and sfa was 21.74% (5/23) and 8.7% (2/23,) respectively. The gene coding for afimbrial adhesin afa was 30.43% (7/23).

Nine isolates were positive for more than one adhesive gene. pap and sfa genes were detected in seven (30.43%) while pap and afa were detected in two 8.7% isolates. None of the samples were positive for afa and sfa or all the three genes together.

All the three genes recorded among the hospitalised patients pap 17.6%, sfa and afa 14.03% were higher compared with ambulatory pap 9.3%, Sfa and afa 2.3%.

A total of 60% of UPEC strains were positive for haemolysin production and there was no discrimination between ambulatory and hospitalised patients.

A total of 80% of UPEC strains and ≥ 90% of UPEC strains showing adhesive genes were positive for Congo red dye uptake.


 ~ Discussion Top


Our results are in agreement with earlier reports that showed the predominance of pap genes among the UPEC strains. [8] This assumes significance as P-fimbriae are reported to play a crucial role in mediating adherence and invasion of human kidney leading to pyelonephritis, which is considered a serious complication of E. coli UTI. [1] In this study, UPEC isolates possessing the afa gene confirms the presence of afa afimbrial adhesins. The presence of pap and afa virulence genes were 50.4% and 8.13%, respectively, indicating high presence of virulence genes in patients with UTIs in Iran as described by Karimian et al. [9]

The presence of higher numbers of combined pap and sfa genes observed is in accordance with earlier reports. [10],[11] The higher number of samples having pap and sfa genes together as compared with other combinations could be due to the localisation of these genes on the same pathogenicity island of UPEC strains. [12],[13] In contrast sfa and afa gene combination among UPEC isolates in this study agrees to previous observations wherein they report this gene combination to have been either absent or less documented. [6],[8],[11]

In this study, a comparison of the distribution of adhesive genes among hospitalised and ambulatory show that adhesive genes are more among hospitalised patients. These findings conclude the significant role of pap, sfa and afa genes in the hospitalised patients suffering with UTIs. The prevalence of multiple adhesive genes indicate the potential to adhere and subsequently cause a systemic infection among these UTI-infected patients. However, these results are in contrast to earlier published reports, [8],[14] which reveal the prevalence of adhesive genes to be higher in ambulatory cases. This could be attributed to the spread of strains belonging to the same clonal origin within hospitals and emphasise the importance of good management practices to prevent colonisation and spread within hospitals.

There was no correlation observed between haemolysin production and strains positive for adhesive genes [Table 1]. The simultaneous occurrence of P fimbriae and haemolysin among UPEC strains as observed in our study confirms with other reports. [15] Haemolysin production is considered an important virulence marker among nephropathogenic strains [6] and therefore the prevalence of haemolysin producing UPEC strains in this study assumes significance. Congo red absorption has been associated with virulence and pathogenicity among several bacterial species including E. coli causing avian septicaemia [7] and UPEC strains. [11]
Table 1: Prevalence of more than one adhesive gene, Congo red uptake and haemolysin production among UPEC isolates

Click here to view


Our study is in agreement with the recent study by Alepopoulou et al., that the strains with multiple adhesive genes may further increase the risk for development of UTI specifically in women and also occurrence of pap was higher compared with other genes. These adhesins are produced by some urinary E. coli strains shown to bind specifically to sialosyl-oligosaccharide residues. The epidemiological evidence suggests that S fimbriae adhesins play a major role in UTI.

Further studies with more number of samples are required to assess its clinical relevance for a better diagnosis of patients with UTI. It would be important to extract DNA from urine samples to look for the adhesion genes for a more realistic prevalence.


 ~ Acknowledgements Top


The authors thank the Department of Microbiology, K. S. Hegde Medical Academy, Deralakatte and Kasturba Medical College, Mangalore for providing samples. Molecular work was supported by UNESCO MIRCEN for Biotechnology, Department of Microbiology, College of Fisheries, Mangalore.

 
 ~ References Top

1.Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol 2004;2:123-40.  Back to cited text no. 1
    
2.Johnson JR. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev 1991;4:80-128.  Back to cited text no. 2
[PUBMED]    
3.Ott M, Hoschutzky H, Jann K, Van Die I, Hacker J. Gene clusters for S fimbrial adhesin (sfa) and F1C fimbriae (foc) of Escherichia coli: Comparative aspects of structure and function. J Bacteriol 1988;170:3983-90.  Back to cited text no. 3
    
4.Le Bouguénec C, Archambaud M, Labigne A. Rapid and specific detection of the pap, afa and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol 1992;30:1189-93.  Back to cited text no. 4
    
5.Ishitoya S, Yamamoto S, Kanamaru S, Kurazono H, Habuchi T, Ogawa O, et al. Distribution of afaE adhesins in Escherichia coli isolated from Japanese patients with urinary tract infection. J Urol 2003;169:1758-61.  Back to cited text no. 5
    
6.Blanco M, Blanco JE, Alonso MP, Mora A, Balsalobre C, Munoa F, et al. Detection of pap, sfa and afa adhesin- encoding operons in uropathogenic Escherichia coli strains: Relationships with expression of adhesins and production of toxins. Res Microbiol 1997;148:745-55.  Back to cited text no. 6
    
7.Berkhoff HA, Vinal AC. Congo red medium to distinguish between invasive and non-invasive Escherichia coli pathogenic for poultry. Avian Dis 1985;30:117-21.  Back to cited text no. 7
    
8.Santo E, Macedo C, Marin JM. Virulence factors of uropathogenic Escherichia coli from a University Hospital in Ribeirão Preto, São Paulo, Brazil. Rev Inst Med Trop Sao Paulo 2006;48:185-8.  Back to cited text no. 8
    
9.Karimian A, Momtaz H, Madani M. Detection of uropathogenic Escherichia coli virulence factors in patients with urinary tract infections in Iran. Afr J Microbiol Res 2012;6:6811-6.  Back to cited text no. 9
    
10.Bogyiova E, Kmetova M, Biros E, Siegfried L. Detection of pap-, sfa- and afa-specific DNA sequences in Escherichia coli strains isolated from extraintestinal material. Folia Microbiol (Praha) 2002;47:723-6.  Back to cited text no. 10
    
11.Silveira WD, Benetti F, Lancellotti M, Ferreira A, Solferini VN, Brocchi M. Biological and genetic characteristics of uropathogenic Escherichia coli strains. Rev Inst Med Trop Sao Paulo 2001;43:303-10.  Back to cited text no. 11
    
12.Dobrindt U, Blum-Oehler G, Hartsch T, Gottschalk G, Ron EZ, Funfstuk R, et al. S-Fimbria-encoding determinant sfaI is located on pathogenicity island III 536 of uropathogenic Escherichia coli strain 536. Infect Immun 2001;69:4248-56.  Back to cited text no. 12
    
13.Tiba MR, Yano T, Leite Dda S. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev Inst Med Trop Sao Paulo 2008;50:255-60.  Back to cited text no. 13
    
14.Ikaheimo R, Siitonen A, Karkkainen U, Makela PH. Virulence characteristics of Escherichia coli in nosocomial urinary tract infection. Clin Infect Dis 1993;16:785-91.  Back to cited text no. 14
    
15.Naveen R, Mathai E. Some virulence characteristics of uropathogenic Escherichia coli in different patient groups. Indian J Med Res 2005;122:143-7.  Back to cited text no. 15
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04