Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 3283 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (933 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~ Case Report
 ~ Discussion
 ~ Conclusion
 ~ Acknowledgment
 ~  References
 ~  Article Figures

 Article Access Statistics
    Viewed2016    
    Printed73    
    Emailed2    
    PDF Downloaded101    
    Comments [Add]    
    Cited by others 1    

Recommend this journal

 


 
  Table of Contents  
CASE REPORT
Year : 2013  |  Volume : 31  |  Issue : 3  |  Page : 302-305
 

Rhizomucor variabilis : A rare causative agent of primary cutaneous zygomycosis


1 Department of Microbiology, Karnataka Institute of Medical Sciences, Hubli, Karnataka, India
2 Department of Dermatology, Karnataka Institute of Medical Sciences, Hubli, Karnataka, India
3 Department of Medical Microbiology, Mycology Division, WHO Collaborating Centre, Centre of Advanced Research in Medical Mycology, Post Graduate Institute of Medical Education and Research, Chandigarh, India
4 Department of Microbiology, Sree Gokulam Medical College, Thiruvananthapuram, Kerala, India

Date of Submission22-Dec-2012
Date of Acceptance12-Jun-2013
Date of Web Publication25-Jul-2013

Correspondence Address:
A B Patil
Department of Microbiology, Karnataka Institute of Medical Sciences, Hubli, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.115662

Rights and Permissions

 ~ Abstract 

Rhizomucor variabilis is a rare cause of human infections. We report a case of primary cutaneous zygomycosis in an immunocompetent host. Although microscopy reveals the fungal aetiology, the need for species identification is highlighted to better understand the species and establish an epidemiological pattern as it is reported from restricted geographical locations.


Keywords: Immunocompetent patient, primary cutaneous zygomycosis, Rhizomucor variabilis


How to cite this article:
Patil A B, Chandramohan K, Shivaprakash M R, Nadgir S D, Lakshminarayana S A. Rhizomucor variabilis : A rare causative agent of primary cutaneous zygomycosis. Indian J Med Microbiol 2013;31:302-5

How to cite this URL:
Patil A B, Chandramohan K, Shivaprakash M R, Nadgir S D, Lakshminarayana S A. Rhizomucor variabilis : A rare causative agent of primary cutaneous zygomycosis. Indian J Med Microbiol [serial online] 2013 [cited 2018 Nov 12];31:302-5. Available from: http://www.ijmm.org/text.asp?2013/31/3/302/115662



 ~ Introduction Top


Rhizomucor species are an infrequent cause of human disease while Rhizomucor variabilis is rarely reported as a pathogen. [1] Immunocompetent patients account for only a small part of all cases of mucormycosis. [2] We report a rare case of primary cutaneous zygomycosis caused by R. variabilis over the right forearm, in an immunocompetent host.


 ~ Case Report Top


A 50-year-old male patient, farmer by occupation, presented to the Department of Dermatology with erythematous plaque over the right forearm of 5 years duration. The lesion started as a small reddish papule and gradually became an indurated plaque over a period of 6 months. Patient clearly remembers a thorn prick injury while working in the farm. There was no history of pain, itching, discharge or bleeding from the lesion. Patient was not a diabetic nor was he on any medication for any ailment. He had not received any treatment prior to his consultation with us. Cutaneous examination revealed a well-demarcated, erythematous, indurated non-tender, normosthenic and crusted plaque measuring 5 cm × 5 cm [Figure 1]. Based on the history and clinical examination differential diagnosis of cutaneous zygomycosis, chromoblastomycosis, lupus vulgaris and sarcoidosis was made.
Figure 1: Clinical presentation: Erythematous plaque measuring 5 cm × 5 cm on the right forearm

Click here to view


Routine haemogram, blood sugar levels, serum sodium, serum potassium, blood urea and creatinine levels were within normal limits. Human immunodeficiency virus and Venereal Disease Research Laboratory tests were non-reactive. Radiological examination of the chest and both hands were normal. Histopathological examination revealed mixed granulomatous inflammatory infiltrate composed of lymphocytes, neutrophils and multinucleated giant cells in the dermis. Ribbon like, aseptate mycelia were observed. Based on these features a diagnosis of cutaneous zygomycosis was made. A biopsy specimen was also sent for fungal culture. Antifungal therapy with fluconazole 200 mg/day was initiated. In addition, a fluconazole solution 2.0 mg/ml was applied locally. Considerable regression in the lesion was noted after 2 months of treatment, but the patient did not follow-up later.

On culture, growth of white woolly colonies filling up the entire tube on the obverse and lemon yellow colour on the reverse was observed on Sabouraud's dextrose agar at 25°C after 4 days of incubation [Figure 2]. A slide culture was made and examined after staining with lactophenol cotton blue stain. Microscopy revealed long ribbon like aseptate hyaline hyphae and hyaline sporangiophores with branched rhizoids. Sporangia were spherical and measured 50-100 μm with ellipsoidal columellae, sporangiospores were globose [Figure 3]. Based on these features, the isolate was identified as Rhizomucor. A repeat biopsy was taken to reconfirm and the same isolate was obtained. The isolate was sent to National Culture Collection of Pathogenic Fungi (NCCPF) at Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India for further identification. At NCCPF, the phenotypic characters of the isolate were studied and reconfirmed. Molecular identification was done by sequencing ITS1-5.8S-ITS2 region of ribosomal deoxyribonucleic acid (DNA) gene. Sequencing was performed using primer pairs ITS1 (GCATATCAATAAGCGGAGGAAAAG) and ITS4 (GGTCCGTGTTTCAAGACGG) with Big Dye Terminator Cycle Sequencing Kit, version 3.1 (Applied Biosystems, CA, USA) for both strands as per the manufacturer's instructions. Sequencing reactions were purified and analysed on ABI 3130 genetic analyser (Applied Biosystems). Sequences of both the strands were used to create the consensus sequence by using BioNumerics software version 6.5 (Applied Maths, Ghent, Belgium). Pair wise identification of the consensus sequence in the GenBank DNA database showed 99% identity (identities of nucleotides-544/550) with R. variabilis isolate MBC006 (GenBank accession JQ885450.1). Based on the above, the isolate was identified as R. variabilis.
Figure 2: Growth on Sabouraud's dextrose agar after 4 days of incubation at 25°C showing white woolly colonies filling the entire tube with yellow colour on the reverse

Click here to view
Figure 3: Photomicrograph (×400) of lactophenol cotton blue mount stain after 4 days showing hyaline, ribbon like, aseptate hyphae; spherical sporangia with ellipsoidal columella and globose sporangiospores

Click here to view



 ~ Discussion Top


Primary cutaneous mucormycosis is an uncommon disease caused by saprophytic fungi of the order mucorales and usually occurs among individuals with predisposing factors such as diabetes, malignancy, solid organ transplantation and trauma. [3] Five clinical forms are recognised viz: Rhinocerebral, pulmonary, gastrointestinal, disseminated and cutaneous. [4] Two different presentations of cutaneous mucormycosis have been described. The superficial type appears as vesicles or pustules that advance to ulceration and eschar formation usually in normal hosts. In the gangrenous type, rapidly progressing ulceration and dissemination is seen. [5] Cutaneous mucormycosis is often secondary to local factors that include trauma, surgery, burns, needle pricks, motor vehicle accidents, insect bites and so on. [3]

Until now, species reported to have caused primary cutaneous mucormycosis include Rhizopus species, Absidia corymbifera, Mucor species, Rhizomucor pusillus, Cunninghamella bertholletiae, Saksenaea vasiformis and Apophysomyces elegans. [6] R. variabilis is a relatively uncommon cause of infection in humans with few published case reports. [1],[4],[6],[7],[8]

Unlike primary cutaneous mucormycosis caused by other mucorales species which usually present with obvious progressive angioinvasive necrotic lesion, cases caused by R. variabilis mainly involve superficial or subcutaneous infections that are more indolent and evolve chronically. In the early phase, infiltrated nodules and plaques could be observed that gradually become confluent and expand outward. Without local stimulation or inducement, the lesions would usually remain localised to their primary sites and gradually expand over many years. [6] In the present case too, the patient presented with plaques and the disease ran a chronic course.

It is interesting to note that the majority of the reported cases are from China. Lu et al.[4],[6] reported a case of primary cutaneous mucormycosis on the face in an adult female, the authors also reviewed six more cases from China, which occurred on the face and upper extremity. Five of them gave a history of trauma, bites or surgery and all had a farming experience, which led to the assumption that environmental exposure after trauma or surgery could be the main risk factor. [6] Similar history was observed in our case. Our patient is a farmer and had a thorn prick prior to the development of skin lesion. A case of primary cutaneous mucormycosis in an immunocompetent person was reported from China in the year 2009. [4] The other two cases, one each reported from Japan and USA were immunocompromised; the first patient was a 78-year-old man who was on oral prednisolone for the last 10 years; [7] the latter was a 14-year-old leukemic patient with lesions on the palate after she underwent a bone marrow transplant. [1]

The first and the only case of mucormycosis caused by R. variabilis was recently reported by Hemashettar et al. [8] It is noteworthy that both the present case and the earlier case of R. variabilis are from the same region (Karnataka state), India. The possibility of the fungus being endemic or geographically restricted to this geographical area needs to be explored further.

R. variabilis has a prominent geographical feature and unlike other global sporadic mucormycosis caused by other species, primary cutaneous mucormycosis due to R. variabilis tends to be an endemic mycosis. [6] In the majority of cases of primary cutaneous mucormycosis reported from India, identification to species level is largely lacking. [8] Identification is usually made on histopathological examination, which makes it difficult to study the epidemiological trends of fungi. This highlights the need for complete species identification by culture and nucleotide sequencing.

Although the first line treatment for cutaneous mucormycosis is amphotericin B [4] and these fungi are resistant to fluconazole, reports of successful therapy with fluconazole, itraconazole, posaconazole and caspofungin are available. [1],[4],[8] Abuali et al., [1] have reported response to treatment with a combination of posaconazole and caspofungin in one case. In another case, despite in-vitro antifungal susceptibility showing resistance to itraconazole, therapy with oral itraconazole (400 mg/day) was initiated and after a 3 month therapy the lesion regressed considerably. The response to itraconazole was explained on the "90-60" rule wherein, infections due to susceptible isolates respond to therapy 90% of the time, whereas infections due to resistant isolates respond 60% of the time. [4] Hemashettar et al., [8] had started treatment with 200 mg fluconazole IV for 7 days and then oral fluconazole was initiated along with a fluconazole solution, which was applied locally 4 times/day. Similar treatment was given in the present case. Although we noticed regression of the lesion after 2 months, the patient did not follow-up later. Resistance to azoles and caspofungin, recurrence after treatment with fluconazole and ketoconazole has also been reported. [6] Use of fluconazole both by oral administration and local application in cutaneous infection caused by R. variabilis cannot be undermined and needs further evaluation.


 ~ Conclusion Top


The primary cutaneous infection due to R. variabilis is a new emerging mucormycosis. [9] Although microscopy suggests a fungal aetiology, it is important to identify the species by culture and nucleotide sequencing. Not only does it aid in initiating a definitive therapy it also helps to understand the species better and to establish an epidemiological pattern so as to alert the clinicians of its presence in a particular region. This becomes especially important in view of the wide ranging differential diagnosis, chronic course of the disease and the invasive nature of the infection. It is also noteworthy that cases of primary cutaneous mucormycosis caused by R. variabilis have been reported among immunocompetent hosts. Hence, a high index of suspicion is crucial warranting a prompt biopsy and culture in cases of primary cutaneous mucormycosis.


 ~ Acknowledgment Top


We would like to acknowledge National Culture Collection of Pathogenic Fungi (NCCPF) of Indian Council of Medical Research and Prof. Arunaloke Chakrabarti, Incharge, NCCPF, PGIMER, Chandigarh and Dr. B. M. Hemashettar for help in identification. We also thank Dr. Fasiha M and Dr. Santosh Gadadavar, for scientific assistance.

 
 ~ References Top

1.Abuali MM, Posada R, Del Toro G, Roman E, Ramani R, Chaturvedi S, et al. Rhizomucor variabilis var. regularior and Hormographiella aspergillata infections in a leukemic bone marrow transplant recipient with refractory neutropenia. J Clin Microbiol 2009;47:4176-9.  Back to cited text no. 1
[PUBMED]    
2.Kumar A, Khilnani GC, Aggarwal S, Kumar S, Banerjee U, Xess I. Primary cutaneous mucormycosis in an immunocompetent host: Report of a case. Surg Today 2003;33:319-22.  Back to cited text no. 2
[PUBMED]    
3.Ledgard JP, van Hal S, Greenwood JE. Primary cutaneous zygomycosis in a burns patient: A review. J Burn Care Res 2008;29:286-90.  Back to cited text no. 3
[PUBMED]    
4.Zhao Y, Zhang Q, Li L, Zhu J, Kang K, Chen L. Primary cutaneous mucormycosis caused by Rhizomucor variabilis in an immunocompetent patient. Mycopathologia 2009;168:243-7.  Back to cited text no. 4
[PUBMED]    
5.Ryan ME, Ochs D, Ochs J. Primary cutaneous mucormycosis: Superficial and gangrenous infections. Pediatr Infect Dis 1982;1:110-4.  Back to cited text no. 5
[PUBMED]    
6.Lu XL, Liu ZH, Shen YN, She XD, Lu GX, Zhan P, et al. Primary cutaneous zygomycosis caused by Rhizomucor variabilis: A new endemic zygomycosis? A case report and review of 6 cases reported from China. Clin Infect Dis 2009;49:e39-43.  Back to cited text no. 6
[PUBMED]    
7.Tomita H, Muroi E, Takenaka M, Nishimoto K, Kakeya H, Ohno H, et al. Rhizomucor variabilis infection in human cutaneous mucormycosis. Clin Exp Dermatol 2011;36:312-4.  Back to cited text no. 7
[PUBMED]    
8.Hemashettar BM, Patil RN, O'Donnell K, Chaturvedi V, Ren P, Padhye AA. Chronic rhinofacial mucormycosis caused by Mucor irregularis (Rhizomucor variabilis) in India. J Clin Microbiol 2011;49:2372-5.  Back to cited text no. 8
[PUBMED]    
9.Lu XL, Liu Z, Shen Y, Liu W. A new emerging mucormycosis: Two case reports and literature review. J Dermatol 2010;37:93-7.  Back to cited text no. 9
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]

This article has been cited by
1 Primary cutaneous mucormycosis caused byMucor irregularisin an elderly person
Sayaka Yamaguchi,Yuko Okubo,Azusa Katano,Ayako Sano,Hiroshi Uezato,Kenzo Takahashi
The Journal of Dermatology. 2014; : n/a
[Pubmed] | [DOI]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04