Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1261 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (546 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusions
 ~ Acknowledgements
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed1557    
    Printed83    
    Emailed0    
    PDF Downloaded100    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2013  |  Volume : 31  |  Issue : 2  |  Page : 166-172
 

Polymorphisms in major cytokine genes: A study among human immunodeficiency Virus-1 serodiscordant couples in Mumbai, India


1 Department of Infectious Diseases Biology, National Institute for Research in Reproductive Health, Mumbai, India
2 Department of Microbiology, Seth G. S. Medical College and KEM Hospital, Mumbai, India

Date of Submission14-Sep-2012
Date of Acceptance16-Apr-2013
Date of Web Publication19-Jul-2013

Correspondence Address:
J Mania-Pramanik
Department of Infectious Diseases Biology, National Institute for Research in Reproductive Health, Mumbai
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.115250

Rights and Permissions

 ~ Abstract 

Purpose: Polymorphism in cytokine genes may affect its production, which play an important role in modulation of human immunodeficiency virus (HIV) infection. Evaluation of these polymorphisms might help to understand why some individuals remain uninfected in spite of several exposures to HIV infection, such as the negative spouses of discordant couples. The aim of this study was to evaluate the association of 22 single nucleotide polymorphisms (SNPs) in 13 cytokine genes and their receptors with HIV infection in serodiscordant couples, attending the Integrated Counselling and Testing Centre of a Municipality Hospital. Materials and Methods: At the end of at least 2 years of follow up, 42 couples were confirmed as being serodiscordant. Genotyping was carried out in blood samples of these couples using the polymerase chain reaction-sequence-specific amplification method. Results: Significantly high frequency of interleukin-1 receptor antagonist IL-1RA mspa 11100 CC ( P = 0.04), tumor necrosis factor-alpha TNF-α −238 AG ( P = 0.01) and IL-4 −33 TT ( P = 0.01) was observed in HIV seropositives (HSP) while frequency of TNF-α −238 GG ( P = 0.02) was significantly high among the exposed uninfected (EU). However, application of Bonferroni correction identified only two SNPs i.e., TNF-α −238 AG and IL-4 −33 TT to be significantly associated with the acquisition of HIV. In remaining cytokine genes, no significant association was observed. Conclusion: Our study highlighted possible association of certain specific polymorphisms with HIV transmission, whereas presence or absence of certain other polymorphism in EU individuals might be offering protection from HIV infection. These variations at the genetic level might help to explore new insights into treatment and HIV prevention strategies.


Keywords: Cytokine genes, discordant couples, human immunodeficiency virus, single nucleotide polymorphism


How to cite this article:
Chaudhari D V, Chavan V R, Kerkar S C, Mehta P R, Mania-Pramanik J. Polymorphisms in major cytokine genes: A study among human immunodeficiency Virus-1 serodiscordant couples in Mumbai, India. Indian J Med Microbiol 2013;31:166-72

How to cite this URL:
Chaudhari D V, Chavan V R, Kerkar S C, Mehta P R, Mania-Pramanik J. Polymorphisms in major cytokine genes: A study among human immunodeficiency Virus-1 serodiscordant couples in Mumbai, India. Indian J Med Microbiol [serial online] 2013 [cited 2019 Jun 20];31:166-72. Available from: http://www.ijmm.org/text.asp?2013/31/2/166/115250



 ~ Introduction Top


Some individuals after exposure to human immunodeficiency virus (HIV) infection, the etiological factor for acquired immunodeficiency syndrome (AIDS), rapidly progress towards AIDS. Another group of infected individuals remain asymptomatic over a period of years with CD4 (cluster of differentiation 4) count more than 500 cells/mm 3 even without antiretroviral treatment. However, there are individuals who even after repeated exposure to the virus remain uninfected. Examples include; commercial sex workers as well as the discordant couples, in which one spouse is infected while the other one though exposed to the infection remain uninfected, and are referred to as "exposed uninfected" (EU). Even a majority of children born to HIV positive mothers remain uninfected. These extensive inter individual variability in response to HIV infection has been attributed to host determinants and variability in multiple genes. [1] The probability of infection through sexual contact although it varies greatly, appears to be lower than that of infection through other routes of exposure. [2] Extensive work has been done to understand various host genetic factors such as human leucocytes antigen (HLA), Chemokines and their receptors, immunological factors, both innate and adaptive immunity role in HIV infection, some of the recent article also reviewed their protective role in EU. [3],[4],[5] In addition to these factors search for more immune correlates such as role of cytokine genes or its expression that confer such protection in different ethnic groups are being conducted to yield helpful clues for vaccine research so that a single vaccine can be effective in different ethnic groups. However, studies are rare in EU, particularly on single nucleotide polymorphisms (SNPs) of cytokine genes that are presumed to be associated with high or low cytokine production. The cytokine genes are highly conserved particularly in promoter regions and any mutation within this region may affect the production of cytokines, or loss of function. [6],[7] Several cytokine gene associations have been studied in HIV infected as well as in a healthy population who are not exposed to this infection. This comparison with a healthy population might not highlight the genes associated with HIV infection because once exposed to HIV, some of these healthy individuals might get the infection. Hence, there is a need for information from HIV exposed, but uninfected individuals (EU). Among the international studies, one report had highlighted the protective association of IL-4-589T with reducing viral loads.[8] IL-10 was reported to be highly polymorphic, and the common haplotype IL-10 H4 was present in higher frequency in rapid progressors as compared to slow progressors and controls. [9] A study in North Americans have shown that HIV-1 seropositive individuals differed significantly from HIV-1 seronegative individuals for several SNPs and haplotypes at the IL4, IL4R, IL6, IL10 loci. [10] Among the few reports from India, in north Indian population, individuals with mutant homozygous interferon-gamma (IFN-γ) AA genotype were reported to be at risk of HIV-1/AIDS. [11] Another comparative study on Indian population between HIV seropositives (HSP), HIV exposed, but seronegatives (HES) and HIV unexposed seronegatives (HSN) revealed that IL10 promoter −592 A allele and −592 AA genotype was present in high frequency in HSPs when compared to HSN. There was no significant association between IL10 −1082 G/A in HSP when compared to HSN and HES. [12] These are few reports that have studied limited SNPs in few cytokine genes in HIV transmission in Indian population as well as in EU. India with 3 rd largest population living with HIV as well as with different ethnic back ground, offers more scope for evaluation of arrays of SNPs in a large number of cytokine genes that may be protecting the host from acquiring HIV infection. This may highlight the "immunologic advantage" that characterizes EU individuals. There is also an advantage to analyse the known SNPs in both Th1 and Th2 cytokine genes so that the SNPs of particular genes associated with HIV transmission could be highlighted. Hence the present study was planned to investigate the known SNPs in 13 different cytokine genes associated with either Th1 or Th2 type of immune response in HIV sero-discordant couples, both HSP and exposed but uninfected (EU) spouse, so as to evaluate their association with HIV transmission.


 ~ Materials and Methods Top


Study population

Ethics committees of the participating institutes had approved the study. This study was initiated in 2006. Individuals or couples attending the Integrated Counselling and Testing Centre (ICTC) of Department of Microbiology of a Municipality Hospital, for HIV screening either voluntarily or as a reference case, were informed about the study. Enrolment of the couples was done if they fulfilled the study criteria and were ready to come for follow-up to the ICTC Centre for hospital based care. Individual pre- and post-test counselling was done for the HIV test. Individuals positive for HIV-1 infection were counselled to bring his/her spouse for HIV testing. Based on the willingness of both the spouses for participation in the HIV testing, the couples were enrolled in the study. Detail clinical history such as age at marriage, HIV detection of the spouse, unprotected sexual exposure of the EU with the HSP before and after HIV detection, frequency of such exposure were taken into consideration to enroll these couples as HIV discordant couples. Informed consent was taken from all the individuals before their participation.

Human immunodeficiency virus screening

HIV testing in each individual for HIV-1 and HIV-2 antibodies was done using three screening tests, first an enzyme-linked immuno sorbent assay test, 'Microlisa-HIV (J. Mitra and Co. Pvt. Ltd, New Delhi)' followed by two rapid tests, "Pareekshak (Bhat Bio-tech India Pvt. Ltd, Bangalore)' and 'Retroscreen HIV (Qualpro Diagnostics, Vema, Goa)'. If two of the three tests were positive, then the individual was considered as HIV positive.

The algorithms followed to detect HIV infection was as per National AIDS Control Organization (NACO)/World Health Organization strategies III guidelines [Graph 1].



Human immunodeficiency virus screening of negative spouse

The HIV status of each EU spouse was confirmed by HIV deoxyribonucleic acid (DNA) polymerase chain reaction (PCR) test. [13] The primers were specifically designed to amplify the nucleotides that code for the dominating neutralizing region (V3) of the HIV-1 external glycoprotein 120. The sequences of primers of first round PCR were 5'-TTCCTTGGGTTCTTGGGAGC-3' and 5' AGGTATCTTTCCACAGCCAG-3'. Primers for second round PCR were 5'-GCAGCAGGAAGCACTATGGG-3' and 5'-CCAGGACTCTTGCCTGGAGC-3'. Amplification reactions were carried out in a total volume of 50 ul reaction mixture. The PCR protocol followed was; 5 min at 94°C followed by 24 cycles, each with 30 s at 95°C, 30 s at 50°C and 30 s for 72°C, with a final extension of 5 min at 72°C. Second round PCR was done with the same PCR conditions as described earlier using 5 μl of the amplified PCR product in a final volume of 50 μl. PCR products were identified in 2% agarose gel electrophoresis.

Follow up of couples

All the enrolled study participants were counselled to come for follow up along with their spouses. The positive individuals of discordant couples were followed up to register their health status by CD4 count. The negative spouses were counselled to come for follow-up to confirm their HIV status. Free condoms were provided throughout the study. We followed up negative spouses based on their current living relationship status.

Specimen collection

5 ml whole blood specimens in Ethylene diamine tetra-acetic acid (EDTA) were collected at the time of enrolment. DNA was extracted using QIAamp DNA Blood Mini kit (QIAGEN GmbH, Hilden). The qualitative as well as quantitative analysis of the extracted DNA was carried out by agarose gel electrophoresis and spectrophotometry respectively. The house keeping ß-globin gene was amplified in each extracted DNA specimen to check presence or absence of inhibitory factors. The primer pair used to amplify ß-globin gene were as follows; Upstream: 5' ACACAACTGTGTTCACTAGC 3', Downstream: 5' GAAACCCAAGAGTCTTCTCT 3'.

Estimation of CD4 count using Becton Dickinson Fluorescent Activated Cell Sorter calibur

CD4 count was done using BD FACS count CD4 kit from BD Biosciences (Bectson Dickinson and Company, San Jose, CA) following the instruction manual provided by the manufacturer. Appropriate amount of monoclonal antibody reagent and whole blood (50 μl) was directly added to the tube to dissolve the lyophilized pellet, releasing a known number of fluorescent beads. During analysis, the absolute number (cells/μl) of positive cells in the sample was determined by comparing cellular events to bead events using BD Multi SET software (Supplied with the instrument, BD FACS Calibur).

Determination of viral load

The viral load analysis was done in plasma with isolation of total nucleic acid using the MagNa pure Compact Nucleic Acid Automated System (Roche Diagnostic, Mannheim, Germany) and spectrophotometrically checked for the purity at 260/280 nm. Subsequently, the viral load was measured by Cobas Taqman Real time PCR (Roche Molecular Systems, Branchburg, NJ) according to the manufacturer's instructions. To assess the quality of the viral load results, randomly selected samples (n = 16), such as those with undetectable values, high viral load values and with intermediate values were reassessed.

Cytokine genotyping

Cytokine genotyping of the study group was performed using Cytokine Genotyping Kit (Invitrogen, Wisconsin, USA). 22 SNPs of 13 cytokines, cytokine receptors and receptor antagonist were typed using this kit. The SNPs studied were: IL-1 α −889, IL-1 β −511, IL-1 β +3962, IL-1R pst1 1970, IL-1RA mspa1 11100, IL-4R α +1902, IL-12 −1188, IFN-γ +874, TGF-β1 codon 10 and 25, Tumor necrosis factor-alpha (TNF-α) −308, −238, IL-10 −330, +166, IL-4 −1098, −590, −33, IL-6 −174, nt 565 and IL-10 −1082, −819, −592. The amplified products were resolved on 2% agarose gel. All single nucleotide gene polymorphisms were assessed based on the sizes of the amplified products for the respective cytokine genes with internal control.

Statistical analysis

Allelic frequencies of all cytokine genes were estimated by allele counts and expressed as a percentage. Comparison between HSP and EU was done using Stat Calc program, Epi Info version 6.04, CDC, Atlanta, GA, USA for 2 × 2 contingency tables, Chi-square test (χ2 ) with Yates correction, Odd's ratio and relative risk. Frequencies were also tested for Hardy-Weinberg equilibrium (HWE) by calculating allele frequencies using the Pearson's Chi-square test (χ2 ) with 1° of freedom. Findings were considered significant with two-tailed Fisher's exact tests (P < 0.05). These P values were again assessed using the Bonferroni correction. For allele analysis, Bonferroni correction was applied to determine significant level (0.05/n where 'n' is the sum of SNPs in a gene).


 ~ Results Top


234 discordant couples were counselled about the study during the period 2006-2011. However, there were only 42 discordant couples who completed 24 months follow-up and hence further analysis was carried out only in these couples. All of these negative spouses were HIV antibody negative as well as negative for HIV-1 DNA PCR and were considered as discordant couples. Among the 234 discordant couples counselled, 66 couples and 45 EU refused to participate at the initiation of the study while three negative spouses were ready to participate, but their positive spouses refused. Further during follow-up at 3, 6, 12, 18, 24 months, 15, 8, 15, 9, 7 negative spouses (total: 54) respectively refused to continue and their participation was disrupted. At the end of 6 month follow up 2 become concordant. Blood specimen was insufficient in another 22 positive spouses, among them four died during the study and 18 denied to give blood on second follow-up though their negative spouses were in the study; hence at the end of 2 years follow-up complete analysis was carried out in the remaining 42 discordant couples.

Among the positive spouses (HSP); 29 were males and 13 were females. Heterosexual contact (33.33%) was the major route of transmission; however, in the rest (66.67%), though the route of transmission was different, these HSP were sexually active and had sexual contact with their negative spouses, exposing them repeatedly to HIV infection. Hence, they were considered as eligible discordant. Of the 42 HSP, 30 were not on antiretroviral treatment. Thirteen had tuberculosis infection in the past and were treated for the same. Besides Herpes zoster, Hepatitis B virus (HBV) and Hepatitis C virus (HCV) no other sexually transmitted infection was detected in these couples. The characteristics of these couples are presented in [Table 1].
Table 1: Characteristics of HIV-1 discordant couples

Click here to view


Except one who was married in 1991 and separated from her spouse after the HIV detection in 2008, all were living together for a period of 2 years to 34 years even after detection of HIV in their spouse. The time gap between the HIV detection in one spouse and screening of the other spouse varied from 0 months (immediate) to 9 years. Immediate HIV screening of the other spouse at 0 month was carried out in nine couples. All positive spouses (n = 27) had unprotected relationship with their spouse even after counselling, at least 2-3 times or more, within 6-7 months after their enrolment. Rest of the serodiscordant couples (n = 15) did not consistently use protective methods while having sexual contact. The frequency of coitus, i.e., vaginal intercourse between these couples varied from 1 to 3/month. The number of follow ups of negative spouse (EU) ranged from 2 to 4 times/year.

Results of viral load analysis revealed nine had undetectable viral load and three of them were on antiretroviral therapy (ART). HIV-1 viral load was a confounding factor of HIV transmission; however, before detection of HIV, viral load measurement or initiation of ART, these couples were having sexual contacts and the negative spouse was exposed to the infection several times, hence, these couples were also included as discordant in the study.

The genotype frequency was calculated for all cytokine genes loci [Figure 1]. Distribution of the cytokine gene polymorphism did not deviate from HWE. Frequency of IL-1RA mspa 11100 CC, TNF-α −238 AG and GG and IL-4 −33 TT varied significantly between HSP and EU. In HSP, IL-1RA mspa 11100 CC (10.5% vs. 0%, P = 0.04), TNF-α −238 AG (31.5% vs. 7.5%, P = 0.01), IL4 −33 T (18.1% vs. 0%, P = 0.01) were found to be significantly higher compared to EU. Similarly, homozygous genotype of TNF-α −238 GG was significantly in high frequency in EU (90% vs. 65.7%, P = 0.02), revealing a protective effect against HIV transmission. Only the SNPs with significant variation between HSP and EU are presented [Table 2]. However, application of Bonferroni correction indicated a significant difference only in TNF −238 AG and IL4 −33 TT.
Figure 1: Gel representation of different cytokine genes and receptors

Click here to view
Table 2: Significant difference in genotype frequency observed in HIV-1 serodiscordant couples

Click here to view


The other genotypic frequencies IL- 1a, IL- 1b, IL- 4Ra, IL- 12, IFN- g, IL- 2, IL- 4, IL- 6, IL- 10 did not show any significant difference between HSP and EU. When a comparison of the haplotypes of these cytokine genes was carried out, no statistical significant difference was observed.

During the 2 year follow-up, two spouses became HIV positive; however, there was no difference in frequency of SNPs in any of the studied cytokine genes.


 ~ Discussion Top


This study for the first time reported analysis of SNPs in 13 cytokine genes and their receptors among HIV serodiscordant couples in an Indian population. High frequencies of IL-1RA mspa 11100 CC, TNF-α −238 AG and IL- 4 −33 TT genotypes observed in HSP suggested their possible role in the acquisition of infection. The frequency of TNF-α −238 GG was observed to be high in EU compared to HSP. No other association was observed in the remaining cytokines genes in our study cohort. Though, there were only four SNPs which were significantly different between the two groups, further application of Bonferroni correction indicated only two of them were significantly associated with the acquisition or protection from HIV infection. These observations were important as no report on local or in any other Indian population was available on evaluation of these 22 SNPs in 13 cytokine genes between HSP and EU. Besides these, certain polymorphism in IL4 and IL10 with HIV infection was reported in HIV positive Caucasians population and in high risk North Americans. [9],[10] We also observed a high frequency of IL-10 promoter −592 AA genotype, though not significant, among the HSP, which was similar to a comparative study in Indian population between HIV positive and exposed but seronegative (HSN), indicating possible significant association of IL10 promoter −592 A and −592 AA genotype with higher risk of acquisition. [12] IFN-γ AA genotype was reported to be associated with risk of HIV-1/AIDS in HIV infected Indians; [11] however, in our study population frequency of IFN-γ AA genotype in both HSP and EU was similar, indicating no such association.

IL-1RA is a naturally occurring inhibitor of IL-1a and IL-1b. IL-1 is a critical mediator of the inflammatory response, playing an important part in development of pathologic condition. IL-1RA has been shown to block induction of HIV replication in vitro,[14],[15],[16] and ART results in increased levels of interleukin-1 receptor antagonist (IL-1RA). [17] The effect of IL-1RA mspa 11100 C/T polymorphism in its secretion/expression is not known. No reports are also available on frequency of this polymorphism in Indian population. Our results showed IL-1RA mspa1 11100 C/C genotype present exclusively in HSP while frequency of C/T and T/T polymorphism was similar in both the groups, indicating its probable association with the acquisition of infection. However, its association with expression or inhibition of IL-RA needs further evaluation to confirm its association with HIV transmission.

TNF-α AG genotype increases transcriptional activity resulting in increased production of TNF-α while TNF-α GG genotype is responsible for decrease in cytokine level. [18],[19] Accordingly in the presence of −308 GG and −238 GG, low or insignificant transcriptional activities with low TNF-α level in EU might be playing a significant role in preventing HIV infection. These findings on significant association of −238 AG genotype or −308 GA variant with HSP correlated with other reports that suggest; TNF-α levels are elevated in persons with HIV-1 infection. [20] TNF-α alone or in synergy with other cytokines may up-regulate HIV replication and production in host cells. [16]

The IL-4 −33T accelerates HIV infection and disease progression through suppression of cellular immunity, which plays an important role in controlling HIV-1 in infected individuals. IL-4 −33 TT polymorphism was present exclusively in HSP and might be involved in similar activities. Presence of IL-4 −589 T mutation is completely linked with IL-4 −33 T, which was associated with the acquisition of syncytia-inducing variants and elevated levels of total IgE in HIV infected individuals. Presence of comparatively high proportion of SNP −590T in IL-4 promoter region among HSP reported to be associated with enhanced IL-4 promoter strength as well as IL-4 activity and production. [21] High proportion of IL-4-590 C/T promoter polymorphism seen among the HSP compared to EU needs further evaluation as a previous study from India reported no association of IL-4-590 C/T with the risk of HIV infection. [22]

A report suggested the homozygous effect of TGF-β TT at codon 10/GG at codon 25 on increased production of TGF β1. [23] In our study, increase in TGF-β TT genotype frequency might lead to increase in its transcription in few HSP, however, there was no significant difference in the frequencies of SNPs in TGF-β1 codon 10 and 25 between HSP and EU.

Expression of genes and its product regulates the infection outcomes while the present study was limited to identification of SNPs in different genes and their association with HSP and EU. This identification might contribute to decide, which SNPs should be taken into consideration to measure its expression following an exposure to HIV infection. In the present study, identified SNPs were evaluated for their possible association using the existing available reports on SNPs and its levels. Another limitation of the study was number of discordant couples enrolled. Ethics did not permit us to take blood without the consent of these vulnerable study participants and due to confidentiality we could not make a home visit, who did not come for follow-up. However, analysing 22 SNPs in both Th1 and Th2 cytokine genes in a group of 42 discordant couples could identify their possible association either with HIV infection or with its protection.

How polymorphisms in cytokines, HLA and other genes interact, ultimately to determine genetic susceptibility to HIV remains an open question. The present study evaluated polymorphisms in a group of genes that are known to be associated with either Th1 or Th2 type of response. Presence of SNPs associated with high production of IL-4 or TNF-α indicated down regulation of cell mediated immunity leading to possible acquisition or absence of these SNPs leading towards cell mediated immunity (Th1) might have offered protection from HIV infection.


 ~ Conclusions Top


Present study on HIV discordant couples highlighted the association of certain cytokine SNPs with HIV transmission, whereas the presence of certain other SNPs offered protection to a group of individuals who were exposed to infection but were not infected. This observed individual variation at the genetic level might help to explore new pathways to develop more accurate diagnostic tools that might be critical to gain new insights into promising treatment and HIV prevention strategies. This study also adds information on different SNPs present in the population.


 ~ Acknowledgements Top


We acknowledge the financial support from Department of Biotechnology and Indian Council of Medical Research, Government of India. Participation of HIV discordant couples is also highly acknowledged.

 
 ~ References Top

1.Fowke KR, Nagelkerke NJ, Kimani J, Simonsen JN, Anzala AO, Bwayo JJ, et al. Resistance to HIV-1 infection among persistently seronegative prostitutes in Nairobi, Kenya. Lancet 1996;348:1347-51.  Back to cited text no. 1
[PUBMED]    
2.Royce RA, Seña A, Cates W Jr, Cohen MS. Sexual transmission of HIV. N Engl J Med 1997;336:1072-8.  Back to cited text no. 2
    
3.Miyazawa M, Lopalco L, Mazzotta F, Lo Caputo S, Veas F, Clerici M, et al. The 'immunologic advantage' of HIV-exposed seronegative individuals. AIDS 2009;23:161-75.  Back to cited text no. 3
    
4.Restrepo C, Rallón NI, Carrillo J, Soriano V, Blanco J, Benito JM. Host factors involved in low susceptibility to HIV infection. AIDS Rev 2011;13:30-40.  Back to cited text no. 4
    
5.Taborda-Vanegas N, Zapata W, Rugeles MT. Genetic and Immunological Factors Involved in Natural Resistance to HIV-1 Infection. Open Virol J 2011;5:35-43.  Back to cited text no. 5
[PUBMED]    
6.Bidwell J, Keen L, Gallagher G, Kimberly R, Huizinga T, McDermott MF, et al. Cytokine gene polymorphism in human disease: On-line databases, supplement 1. Genes Immun 2001;2:61-70.  Back to cited text no. 6
[PUBMED]    
7.Haukim N, Bidwell JL, Smith AJ, Keen LJ, Gallagher G, Kimberly R, et al. Cytokine gene polymorphism in human disease: On-line databases, supplement 2. Genes Immun 2002;3:313-30.  Back to cited text no. 7
[PUBMED]    
8.Nakayama EE, Meyer L, Iwamoto A, Persoz A, Nagai Y, Rouzioux C, et al. Protective effect of interleukin-4-589T polymorphism on human immunodeficiency virus type 1 disease progression: Relationship with virus load. J Infect Dis 2002;185:1183-6.  Back to cited text no. 8
[PUBMED]    
9.Vasilescu A, Heath SC, Ivanova R, Hendel H, Do H, Mazoyer A, et al. Genomic analysis of Th1-Th2 cytokine genes in an AIDS cohort: Identification of IL4 and IL10 haplotypes associated with the disease progression. Genes Immun 2003;4:441-9.  Back to cited text no. 9
[PUBMED]    
10.Wang C, Song W, Lobashevsky E, Wilson CM, Douglas SD, Mytilineos J, et al. Cytokine and chemokine gene polymorphisms among ethnically diverse North Americans with HIV-1 infection. J Acquir Immune Defic Syndr 2004;35:446-54.  Back to cited text no. 10
[PUBMED]    
11.Sobti RC, Salih AM, Nega B, Seyed AH, Rupinder K, Vijesh K, et al. Insights into the role of IL-12B and IFN-gamma cytokine gene polymorphisms in HIV-1/AIDS infection. Folia Biol (Praha) 2010;56:110-5.  Back to cited text no. 11
[PUBMED]    
12.Chatterjee A, Rathore A, Sivarama P, Yamamoto N, Dhole TN. Genetic association of IL-10 gene promoter polymorphism and HIV-1 infection in North Indians. J Clin Immunol 2009;29:71-7.  Back to cited text no. 12
[PUBMED]    
13.Albert J, Fenyö EM. Simple, sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J Clin Microbiol 1990;28:1560-4.  Back to cited text no. 13
    
14.Goletti D, Kinter AL, Hardy EC, Poli G, Fauci AS. Modulation of endogenous IL-1 beta and IL-1 receptor antagonist results in opposing effects on HIV expression in chronically infected monocytic cells. J Immunol 1996;156:3501-8.  Back to cited text no. 14
[PUBMED]    
15.Granowitz EV, Saget BM, Wang MZ, Dinarello CA, Skolnik PR. Interleukin 1 induces HIV-1 expression in chronically infected U1 cells: Blockade by interleukin 1 receptor antagonist and tumor necrosis factor binding protein type 1. Mol Med 1995;1:667-77.  Back to cited text no. 15
[PUBMED]    
16.Poli G, Kinter AL, Fauci AS. Interleukin 1 induces expression of the human immunodeficiency virus alone and in synergy with interleukin 6 in chronically infected U1 cells: Inhibition of inductive effects by the interleukin 1 receptor antagonist. Proc Natl Acad Sci U S A 1994;91:108-12.  Back to cited text no. 16
[PUBMED]    
17.Sadeghi HM, Weiss L, Kazatchkine MD, Haeffner-Cavaillon N. Antiretroviral therapy suppresses the constitutive production of interleukin-1 associated with human immunodeficiency virus infection. J Infect Dis 1995;172:547-50.  Back to cited text no. 17
[PUBMED]    
18.Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci U S A 1997;94:3195-9.  Back to cited text no. 18
[PUBMED]    
19.Kroeger KM, Carville KS, Abraham LJ. The-308 tumor necrosis factor-alpha promoter polymorphism effects transcription. Mol Immunol 1997;34:391-9.  Back to cited text no. 19
[PUBMED]    
20.Roux-Lombard P, Modoux C, Dayer JM. Production of interleukin-1 (IL-1) and a specific IL-1 inhibitor during human monocyte-macrophage differentiation: Influence of GM-CSF. Cytokine 1989;1:45-51.  Back to cited text no. 20
[PUBMED]    
21.Nakayama EE, Hoshino Y, Xin X, Liu H, Goto M, Watanabe N, et al. Polymorphism in the interleukin-4 promoter affects acquisition of human immunodeficiency virus type 1 syncytium-inducing phenotype. J Virol 2000;74:5452-9.  Back to cited text no. 21
[PUBMED]    
22.Chatterjee A, Rathore A, Dhole TN. Association of IL-4 589 C/T promoter and IL-4RalphaI50V receptor polymorphism with susceptibility to HIV-1 infection in North Indians. J Med Virol 2009;81:959-65.  Back to cited text no. 22
[PUBMED]    
23.Awad MR, El-Gamel A, Hasleton P, Turner DM, Sinnott PJ, Hutchinson IV. Genotypic variation in the transforming growth factor-beta1 gene: Association with transforming growth factor-beta1 production, fibrotic lung disease, and graft fibrosis after lung transplantation. Transplantation 1998;66:1014-20.  Back to cited text no. 23
[PUBMED]    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04