Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 2285 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (452 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Conclusion
 ~  References
 ~  Article Figures

 Article Access Statistics
    Viewed5889    
    Printed146    
    Emailed1    
    PDF Downloaded203    
    Comments [Add]    
    Cited by others 2    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2013  |  Volume : 31  |  Issue : 1  |  Page : 10-14
 

Comparison of two recombinant systems for expression of cholera toxin B subunit from Vibrio cholerae


1 Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran; Department of Biology, Faculty of Basic Science, Science and Research Branch, Islamic Azad University, Tehran, Iran
2 Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
3 Department of Research and Development, Research and Production Complex, Pasteur Institute of Iran, Iran
4 Department of Pilot Biotechnology, Pasteur Institute of Iran, Iran

Date of Submission26-May-2012
Date of Acceptance21-Aug-2012
Date of Web Publication15-Mar-2013

Correspondence Address:
B Bakhshi
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran
Iran
Login to access the Email id

Source of Support: The study was funded by Iranian National Science Foundation Grant No. 90007471., Conflict of Interest: None


DOI: 10.4103/0255-0857.108705

Rights and Permissions

 ~ Abstract 

Purpose: The aim of this study was to assess the production of recombinant cholera toxin B subunit (rCTB) protein in two different expression systems (pAE_ctxB and pQE_ctxB constructs) in Escherichia coli BL21 (DE3). Materials and Methods: The ctxB fragment was amplified from Vibrio cholerae O 1 ATCC14035 and cloned in pGETM-T easy vector after which it was transformed to E. coli Top 10F' and grown on LB-ampicillin agar medium. Sequence analysis confirmed the complete ctxB gene sequence in the construct which was further subcloned to pQE-30 vector. The construct was subsequently transformed to E. coli M15 (pREP4). The recombinant pAE_ctxB and pQE_ctxB were transformed to competent E. coli BL21 (DE3) cells to express CTB protein. Result: Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis showed the maximum expression of rCTB in both systems at 5 h after induction and western blot analysis confirmed the presence of recombinant CTB in blotting membranes. Conclusion: Expression of rCTB in pAE_ctxB construct was more efficient (15-fold) than pQE_ctxB, and it seems that Lac UV5 in E. coli BL21 (DE3) is more compatible with the former construct. This expression system can be used to produce recombinant CTB in high yield which may enable us to study the oral tolerance or mucosal adjuvant properties of rCTB using animal models.


Keywords: ctxB expression, pAE, pQE, Vibrio cholerae


How to cite this article:
Boustanshenas M, Bakhshi B, Ghorbani M, Norouzian D. Comparison of two recombinant systems for expression of cholera toxin B subunit from Vibrio cholerae. Indian J Med Microbiol 2013;31:10-4

How to cite this URL:
Boustanshenas M, Bakhshi B, Ghorbani M, Norouzian D. Comparison of two recombinant systems for expression of cholera toxin B subunit from Vibrio cholerae. Indian J Med Microbiol [serial online] 2013 [cited 2019 Aug 17];31:10-4. Available from: http://www.ijmm.org/text.asp?2013/31/1/10/108705



 ~ Introduction Top


Cholera is a lethal diarrheal disease caused by Vibrio cholerae. The division of V. cholerae into different serogroups is based on its major surface antigen which is called O antigen. Only O 1 and O 139 serotypes are known to cause cholera epidemics. [1] Seven cholera epidemics have occurred all over the world and its outbreaks continue to occur in Iran and other developing countries. [2],[3],[4] Cholera still remains a major problem in countries with poor economic and social conditions in which access to safe water and proper sewage system is not fully provided.

Cholera symptoms are mainly produced by cholera toxin (CT), an enterotoxin which is coded by ctxAB operon that is part of a filamentous bacteriophage genome and composed of two subunits. Subunit A (CTA) is a 28-kDa protein with an enzymatic toxic ability which can increase cellular adenylate cyclase level in intestinal cells and accelerates the secretion of chloride and bicarbonate from the mucosal cells into the intestinal lumen and eventually cause diarrhoea. Subunit B (CTB) is a pentameric protein responsible for binding to GM 1 ganglioside receptor on the surface of host intestinal epithelial cells and facilitates endocytosis of CTA to cells. Molecular weight of each CTB monomer is approximately 11.6 kDa and is recognised as a potent immunogen in intestinal and nasal mucosal sites. [5] The studies indicated that this protein can significantly stimulate the immune system and create immunity against V. cholerae infection. On the other hand, CTB has been reported to stimulate serum secretory antibodies against antigens that are usually poor immunogens; specially when presented together in chemically conjugated or genetically fused forms. [6] It is now accepted that V. cholerae cannot be eradicated from its natural aqueous reservoirs. [7] According to studies, development of an effective vaccine is one of the ways to prevent or control cholera. A single oral clinical infection caused by V. cholerae can induce long-term immunity and adequate immune response can be achieved if appropriate antigens are delivered in combination with V. cholerae. Based on this understanding, variety of vaccines against cholera were developed; vaccines are divided into two principal kinds, the killed- and live-attenuated V. cholerae vaccines. [8] Produced vaccines against cholera have been developed over time and with the advent of recombinant DNA knowledge, different types of potent recombinant strains of V. cholerae were emerged to be used for producing vaccines. [9] In this study, two different expression vectors (pAE_ctxB and pQE_ctxB) were evaluated to express recombinant CTB in E. coli BL21 (DE3) strain and the production process was optimised and characterised.


 ~ Materials and Methods Top


Selection and construction of recombinant vectors

Two different plasmid vectors were selected for CTB production. pQE plasmid was purchased from Qiagen (Valencia, CA). ctxB gene was amplified by PCR using V. cholerae O 1 ATCC14035 DNA as template and ctxB-F (5'GCG TCATGA TTA AAT TAA AAT TTG GTGTTT TTT TTA CAG TTT/TAC3'/ctxB-R (5'CGCTCGAGGGAACCGCGTGGCACCAGATT TGCCATAGTAATTG 3') as primers, whereas BspHI and XhoI restriction sites have been designed in primer sequences. Amplified ctxB was cloned in pGETM-T easy vector (Promega) and transformed to  Escherichia More Details coli Top 10F' (Invitrogen, Carlsbad, CA, USA) grown on LB agar medium containing ampicillin, 100 μg/l; IPTG (Isopropyl β-D-1-thiogalactopyranoside) 40 μg/l; and X-gal. 30 μg/l. White colonies were selected and grown in ampicillin-containing LB broth for 4 h and plasmids were extracted using QIAprep Spin Miniprep Kit (Qiagen). Sequence analysis (Genfanavaran, Macrogen, Seoul, Korea) of extracted plasmids with SP6 and T7-promoter universal primers was performed to confirm the ctxB sequence. The pGEM-T_ctxB construct was then digested with BspHI and XhoI restriction enzymes and subjected to subcloning to NcoI and XhoI digested pQE-30 vector. The construct was transformed to E. coli M15 (pREP4) (Qiagen). The second construct (pAE_ctxB) was kindly provided by Dr. Arκas from Institute of Butantan of Brazil.

Expression of recombinant CTB protein in Escherichia coli

E.
coli BL21 (DE3) was used as an expression host in this study (Invitrogen, Carlsbad, CA). As both plasmid vectors used in this study have the T 7 RNA polymerase gene as a promoter for the ctxB gene and the induction of this gene in E. coli BL21 (DE3) is affected by IPTG, this substance (1 mol/l) was used as inducer for LB broth cultures supplemented with ampicillin (1 mmol/l) at OD 600 . The cells were harvested after 5 h and subjected to centrifugation at 4°C, 4000 g for 20 min.

Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis and Western blotting

Lysis buffer (100 mmol/l, NaCl'; 50 mmol/l, Tris-Cl; 1 mmol/l, EDTA; and 0.1 v/w %, Triton X-100) in combination with sonication was used for lysing the cells. Each sample was boiled for 10 min and subjected to electrophoresis on two separate 15% (v/w) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels under the same running conditions.

Each sample of bacteria from pervious step was resuspended in 160 μl lysis buffer. One of the gels was stained with 1% (v/w) Coomassie brilliant blue R-250 to be visualised and the other gel was subjected to protein blotting onto polyvinylidene difluoride (PVDF) membrane (Hi-bond Amersham Biosciences, Piscataway, NJ, USA) using semi-dry blotting system (BioRad, Hercules, CA, USA). Membranes were blocked in blocking buffer containing 1% non-fat milk powder in phosphate buffer saline (PBS) at 4°C overnight after which membranes were incubated sequentially with 1:1000 dilution of rabbit polyclonal anti-CT antibody (Sigma-Aldrich, St. Louis, MO, Germany) and 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Sigma-Aldrich, St. Louis, MO, Germany), followed by washing steps. Producing of recombinant CTB was detected with bound antibodies using chemiluminescent substrate, ECL (Enhanced chemiluminescence) (Hi-bond Amersham Biosciences, Piscataway, NJ, USA). Chemiluminescence on PVDF membrane was detected by exposure to Kodak X-Omat Blue Autoradiography Film. Protein expression in both constructs was evaluated using FireReader D56 software (UVI Tec, UK).


 ~ Results Top


Extracted plasmids from E. coli Top10F' transformed with pGEM-T_ctxB were digested with EcoRI and two bands of 3000 bp and 390 bp were obtained which corresponded to pGEM-T vector and ctxB gene, respectively [Figure 1]a. Sequence analysis confirmed the complete ctxB gene sequence in the construct.
Figure 1: (a) Plasmid extraction of Escherichia coli Top10F' cells transformed with pGEM-T_ctxB construct. Lanes: 1, pGEM_ctxB digested with EcoRI which shows ctxB fragment at 390 bp; 2, undigested pGEM_ctxB plasmid; 3, 1kb DNA size marker. (b) Enzymatic double digestion of pQE and pGEM_ctxB. Lanes: 1, pQE vector double digested with XhoI and NcoI; 3, pGEM_ ctxB double digested with XhoI and BspHI; 2, 1kb DNA size marker; 4, 100 bp DNA size marker. (c) Double digested pQE and pQE_ctxB plasmids. Lanes: 2, pQE vector double digested with XbaI and XhoI which shows fragment at 400 bp; 3, pQE_ctxB vector shows an 800 bp fragment containing ctxB gene; 1, 100 bp DNA size marker; 4, 1 kb DNA size marker. (d) Enzymatic double digestion of pAE_ctxB. Lanes: 2, undigested pAE_ctxB plasmid; 3 and 4, double digested pAE_ctxB with BamHI and HindIII, which shows ctxB fragment at 360 bp; 1, 1 kb DNA marker

Click here to view


The pGEM-T_ctxB construct digested with BspHI and XhoI restriction enzymes is shown in [Figure 1]b. The approximately 392-bp band which corresponds to the CTB fragment was further purified and applied for subcloning to XhoI and NcoI digested pQE plasmid [Figure 1]b. The identity of pQE_ctxB construct was confirmed by double digestion with XbaI and XhoI [Figure 1]c. The second construct (pAE_ctxB) was confirmed by double digestion with BamHI and HindIII restriction enzymes [Figure 1]d.{Figure 1}

Expression of recombinant CTB

Time gradient was applied to recognise the optimum time period for maximum expression of CTB after induction by IPTG. This experiment showed that 5 h after induction with IPTG at a final concentration of 1mM was the best condition for producing CTB in E. coli BL21 (DE3) [Figure 2]. For both constructs, protein expression was conducted at temperature of 37°C, 1 mM IPTG and stopped at the 5 th h after induction, which was the best condition for producing recombinant CTB, followed by SDS-PAGE analysis [Figure 2]a and c. Immunoblotting was performed to characterise recombinant CTB. Western blot analysis of first system (pQE_ctxB) confirmed the expression of rCTB as the foremost 14.5-kDa band on SDS-PAGE analysis and chemiluminescent visualised immunoblotting [Figure 2]b and d.
Figure 2: (a) SDS-PAGE analysis of expression of recombinant CTB in E. coli BL21 (DE3) using pQE_ctxB as expression vector. Lanes: 1, BL21 (DE3) containing pQE_ctxB before induction with IPTG; 2-6, in dicate 1-5 h after induction, respectively; 7, commercial CT (cholera toxin) used as positive control; 8 and 9, BL21 (DE3) containing pQE used as negative control. (b) Western blot analysis of heated samples probed with anti-CT antibody. Lanes: 1, expression of rCTB in BL21 (DE3) containing pQE_ctxB plasmid before induction with IPTG; 2-6, indicate 1-5 h after induction, respectively; 7, commercial CT used as positive control. (c) SDS-PAGE analysis of expression of recombinant CTB in Escherichia coli BL21 (DE3) using pAE_ctxB as expression vector. Lanes: 1, BL21 (DE3) containing pAE plasmid as the negative control; 2, protein size marker; 3, BL21 (DE3) containing pAE_ctxB before induction with IPTG; 4-8, indicate 1-5 h after induction, respectively. (d) Western blot analysis of heated samples probed with anti-CT antibody. Lanes: 1, expression of rCTB in BL21 (DE3) containing pAE_ctxB plasmid before induction with IPTG; 2-6, indicate 1-5 h after induction, respectively

Click here to view


The oligomeric CTB protein dissociated into monomers of approximately 14 kDa when the cell extract was boiled for 10 min. Monomeric form of rCTB had slightly higher molecular weight than the monomeric form of CTB from commercial Cholera toxin (CT) (11.6 kDa). This discrepancy was due to extra six amino acids (6XHis-tag) that were added to the N-terminus and C-terminus of ctxB gene in pAE_ctxB and pQE_ctxB systems, respectively. The molecular weight of expressed CTB from pQE_ctxB system was ~ 14.5 kDa in comparison to 14-kDa CTB from pAE_ctxB system due to its thrombin sequence which has been added to its C-terminus for removal of His-tag from the expressed protein. The total amount of expressed rCTB with pAE_ctxB in BL21 (DE3) strain before purification was assessed to be approximately 1.2 g/l. while pQE_ctxB produced 0.08 g/l of rCTB in the same host.


 ~ Discussion Top


CTB is recognised as a potent immunogen in the intestinal and nasal mucosal sites which can stimulate immune systems in animal models. [10] In addition, this protein can be used as an adjuvant in vaccines for oral or nasal immunisations in human. [7] Based on previous studies, CTB can be used as an immunogen protein to develop immunity against toxigenic strains of V. cholerae or as an adjuvant to increase immune responses against other antigens which caused many groups to express CTB in several bacterial systems, such as E. coli, [11] Lactobacillus and Bacillus brevis[12],[13] or even V. cholerae strains lacking the CTA gene. [6] Yeasts (Saccharomyces cerevisiae) and plants such as tomato, potato and tobacco have been used to produce recombinant CTB but the amount of expressed protein was too low in these systems. [14]

In this study, two different expression vectors (pAE_ctxB and pQE_ctxB) were evaluated for producing recombinant CTB in E. coli BL21 (DE3) cells.

In a study by Haryanti et al. (2008), pBAD plasmid was used to produce rCTB in E. coli BL21 (DE3) pLysS strain and the recombinant CTB was characterised by immunoblotting using anti His-tag antibody. [15] Specificity of anti His-tag antibodies cannot warranty the prevention of non-specific bindings during immunoblotting, whereas the rabbit polyclonal anti-CT antibody used in our study had more specificity to binding to CTB for that reason there is no non-specific bindings were observed in immunoblotting results.

Arκas et al. (2002) designed CTB subunit gene (ctxB), inserted into pAE plasmid and produced rCTB in E. coli BL21 (SI). Expression of rCTB was induced by NaCl in this system and the basal amount of produced rCTB was high. [16] The production of E. coli BL21 (SI) strain was discontinued recently, so this is important to develop a new efficient expression system for producing recombinant CTB by means of pAE plasmid as an expression vector.

In this study, SDS-PAGE and western blot analysis of recombinant CTB production in both pAE_ctxB and pQE_ctxB plasmids demonstrated that these two systems are highly efficient for producing rCTB. There are some advantages in using these systems which include (i) Target genes in pAE plasmid are expressed under the control of transcription and termination signals of T 7 RNA polymerase are under the control of the lacUV5 promoter, which is induced by IPTG, (ii) the histidine sequence which was added to the recombinant protein in this system makes it possible to purify the produced recombinant proteins through Ni 2+-charged column chromatography and did not represent any apparent limitation for the protein refolding and activity. One additional advantage of pAE_ctxB is deletion of signal peptide sequence from ctxB gene pAE_ctxB plasmid which prevents protein from secretion into culture medium.

In a study by Haryanti (2008), the reaction between anti His-tag antibody and rCTB was detected using 3,3'- diamino benzidine tetrahydrochloride (DAB) as a substrate of HRP-conjugated goat anti-mouse antibody. [15] Sensitivity of DAB in this system cannot assure accurate demonstration of expression, whereas ECL used in our study is more sensitive and can provide a precise detection of proteins from western blots more than chromogenic indicator systems. [17]

Recombinant CTB expression in pAE_ctxB construct in BL21 (DE3) strain was almost 15-fold higher than pQE_ctxB plasmid using the same host; it means that pAE_ctxB is a more efficient construct to produce rCTB in this system. Arκas et al. (2002) used this construct to express rCTB in BL21 (SI) and the yield of produced recombinant CTB before purification was about 0.12 g/l which is 10-fold less than the rCTB yield in BL21 (DE3) used in this study. This disparity may occur because of some differences between two systems including (i) in this study, BL21 (DE3) was used to express rCTB which is induced by IPTG, whereas Arκas et al. (2002) have used BL21 (SI) in which expression of rCTB is induced by NaCl, (ii) the use of LB broth in our system in comparison with the medium used by them (LBON medium, LB broth without NaCl) which may affect the growth of bacteria and consequently their protein expression, (iii) in the present system. The volume of medium used to produce rCTB was 100 ml, whereas Arκas et al. (2002) produced rCTB in larger volume (1 L) which may affect bacterial growth due to the aeration limitations.


 ~ Conclusion Top


pAE plasmid can express a high level of recombinant CTB in E. coli BL21 (DE3), which is almost 15-fold higher than pQE_ctxB. E. coli still remains one of the most useful organisms to produce recombinant proteins compared to other bacteria. Lac UV5 in BL21 (DE3) is compatible with pAE_ctxB plasmid and this expression system can be used to produce recombinant CTB in high yield. This enables us to study the oral tolerance or mucosal adjuvant properties of rCTB using animal models.

 
 ~ References Top

1.Liang W, Wang S, Yu F, Zhang L, Qi G, Liu Y, et al. Construction and evaluation of a safe, live, oral Vibrio cholerae vaccine candidate, IEM108. Infect Immun 2003;71:5498-504.  Back to cited text no. 1
    
2.Bakhshi B, Pourshafie MR, Navabakbar F, Tavakoli A, Shahcheraghi F, Salehi M, et al. Comparison of distribution of virulence determinants in clinical and environmental isolates of Vibrio cholera. Iran Biomed J 2008;12:159-65.  Back to cited text no. 2
[PUBMED]    
3.Bakhshi B, Pourshafie MR. Assessing clonality of Vibrio cholerae strains isolated during four consecutive years (2004-2007) in Iran. Scand J Infect Dis 2009;41:256-62.  Back to cited text no. 3
[PUBMED]    
4.Kanungo S, Sah BK, Lopez AL, Sung JS, Paisley AM, Sur D, et al. Cholera in India: An analysis of reports, 1997-2006. Bull World Health Organ 2010;88:185-91.  Back to cited text no. 4
[PUBMED]    
5.Waldor MK, Mekalanos JJ. Vibrio cholerae O 139 specific gene sequences. Lancet 1994;343:1366.  Back to cited text no. 5
[PUBMED]    
6.Rudin A, Riise GC, Holmgren J. Antibody responses in the lower respiratory tract and male urogenital tract in humans after nasal and oral vaccination with cholera toxin B subunit. Infect Immun 1999;67:2884-90.  Back to cited text no. 6
[PUBMED]    
7.Islam MS, Drasar BS, Sack RB. The aquatic flora and fauna as reservoirs of Vibrio cholerae: A review. J Diarrhoeal Dis Res 1994;12:87-96.  Back to cited text no. 7
[PUBMED]    
8.Thungapathra M, Sharma C, Gupta N, Ghosh RK, Mukhopadhyay A, Koley H, et al. Construction of a recombinant live oral vaccine from a non-toxigenic strain of Vibrio cholerae O 1 serotype inaba biotype E1 Tor and assessment of its reactogenicity and immunogenicity in the rabbit model. Immunol Lett 1999;68:219-27.  Back to cited text no. 8
[PUBMED]    
9.Drasar BS, Forrest BD. Cholera and ecology of Vibrio cholerae. London: Chapman and Hall, Academic Press; 1996.  Back to cited text no. 9
    
10.Sun JB, Holmgren J, Czerkinsky C. Cholera toxin B subunit: An efficient transmucosal carrier-delivery system for induction of peripheral immunological tolerance. Proc Natl Acad Sci U S A 1994;91:10795-9.  Back to cited text no. 10
[PUBMED]    
11.L'hoir C, Renard A, Martial JA. Expression in Escherichia coli of two mutated genes encoding the cholera toxin B subunit. Gene 1990;89:47-52.  Back to cited text no. 11
    
12.Slos P, Dutot P, Reymund J, Kleinpeter P, Prozzi D, Kieny MP, et al. Production of cholera toxin B subunit in Lactobacillus. FEMS Microbiol Lett 1998;169:29-36.  Back to cited text no. 12
[PUBMED]    
13.Goto N, Maeyama J, Yasuda Y, Isaka M, Matano K, Kozuka S, et al. Safety evaluation of recombinant cholera toxin B subunit produced by Bacillus brevis as a mucosal adjuvant. Vaccine 2000;18:2164-71.  Back to cited text no. 13
[PUBMED]    
14.Arzanlou M, Rezaee A, Shahrokhi N, Hossini A, Yasuda Y, Tochikubo K, et al. Expression of cholera toxin B subunit in Saccharomyces cerevisiae. Ann Microbiol 2005;55:145-50.  Back to cited text no. 14
    
15.Haryanti T, Mariana NS, Latifah SY, Yusoff K, Raha AR. Controlled expression of cholera toxin B subunit from Vibrio cholerae in Escherichia coli. Pak J Biol Sci 2008;11:1718-22.  Back to cited text no. 15
[PUBMED]    
16.Arêas AP, Oliveira ML, Ramos CR, Sbrogio-Almeida ME, Raw I, Ho PL. Synthesis of cholera toxin B subunit gene: Cloning and expression of a functional 6XHis-tagged protein in Escherichia coli. Protein Expr Purif 2002;25:481-7.  Back to cited text no. 16
    
17.Constantine NT, Bansal J, Zhang X, Hyams KC, Hayes C. Enhanced chemiluminescence as a means of increasing the sensitivity of western blot assays for HIV antibody. J Virol Methods 1994;47:153-64.  Back to cited text no. 17
    


    Figures

  [Figure 1], [Figure 2]

This article has been cited by
1 Cholera Toxin B: One Subunit with Many Pharmaceutical Applications
Keegan Baldauf,Joshua Royal,Krystal Hamorsky,Nobuyuki Matoba
Toxins. 2015; 7(3): 974
[Pubmed] | [DOI]
2 The hows and whys of constructing a native recombinant cholera vaccine
Mina Boustanshenas,Bita Bakhshi
Bioengineered. 2014; 5(1)
[Pubmed] | [DOI]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04