Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1500 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (391 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Acknowledgment
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed2229    
    Printed131    
    Emailed0    
    PDF Downloaded103    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2012  |  Volume : 30  |  Issue : 2  |  Page : 193-197
 

Construction of a recombinant plasmid harbouring the glyceraldenyde-3-phosphate dehydrogenase gene of periodic Brugia malayi and observation on DNA immunity


Department of Parasitology, School of Basic Medical Sciences, Nantong University, Nantong, Jiangsu - 226 001, China

Date of Submission04-Jan-2012
Date of Acceptance09-Mar-2012
Date of Web Publication28-May-2012

Correspondence Address:
Z Fang
Department of Parasitology, School of Basic Medical Sciences, Nantong University, Nantong, Jiangsu - 226 001
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.96691

Rights and Permissions

 ~ Abstract 

Purpose: Controlling and eliminating lymphatic filariasis will require further research of preventative measures and implementation. Parasite is dependent on glycolysis for ATP production. The glycolytic enzyme glyceraldenyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glycolysis and therefore is either a potential target for anti-parasite drug development or a vaccine candidate. Therefore, we tried to investigate the DNA vaccine-elicited immune responses in BALB/c mice. Materials and Methods: We cloned a gene encoding the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from periodic Brugia malayi into vector pcDNA3.1. Mice were injected at a dosage of 100 μg recombinant plasmid DNA with CpG intramuscular injection and immunized three times at 2-week intervals. pcDNA3.1 and normal saline were used as control. The tissue of muscles at the 4 weeks after the third injection was collected and target genes were detected using RT-PCR. The humoral responses elicited in mice by inoculation with the recombinant plasmid pcDNA3.1-BmGAPDH were detected using a standard ELISA. Two weeks after the third immunization, stimulation index (SI) was measured using the MTT method and the level of secreted IL-4 and INF-g were detected using ELISA. Results: Specific gene fragment coding GAPDH was amplified and the recombinant plasmid pcDNA3.1-BmGAPDH was constructed. Post-challenge sera from the mice immunized with the DNA vaccine had specific antibody titres of 1:1600 to 1:6400, and the highest titre was observed in the mice that were inoculated by pcDNA3.1-BmGAPDH/CpG at 6 weeks. At 4 weeks after immunization, the spleens of the mice were obviously enlarged. The proliferation of spleen T lymphocytes seen on the MTT assay was higher in the pcDNA3.1-BmGAPDH group than in the control group (P value <0.05). The levels of IL-4 and INF-g in serums from the immunized mice were significantly higher than that of the control (P value <0.05). Conclusions: We conclude that the recombinant eukaryotic plasmid pcDNA3.1-BmGAPDH could elicit humoral and cellular immune responses in mice.


Keywords: DNA vaccine, glyceraldenyde-3-phosphate dehydrogenase, immune response, mice, periodic Brugia malayi


How to cite this article:
Fang Z, Tong H, Zhang S, Fang H, Lu S, Xu B. Construction of a recombinant plasmid harbouring the glyceraldenyde-3-phosphate dehydrogenase gene of periodic Brugia malayi and observation on DNA immunity. Indian J Med Microbiol 2012;30:193-7

How to cite this URL:
Fang Z, Tong H, Zhang S, Fang H, Lu S, Xu B. Construction of a recombinant plasmid harbouring the glyceraldenyde-3-phosphate dehydrogenase gene of periodic Brugia malayi and observation on DNA immunity. Indian J Med Microbiol [serial online] 2012 [cited 2019 Jun 16];30:193-7. Available from: http://www.ijmm.org/text.asp?2012/30/2/193/96691



 ~ Introduction Top


Human lymphatic filariasis is currently found in approximately 80 countries. Over one billion people around the world are at risk of lymphatic filariasis infection, and more than 120 million people are already infected, with more than 40 million people incapacitated or disfigured by the disease. [1],[2],[3],[4] Countries where lymphatic filariasis is found are mostly in the tropical and sub-tropical regions of the world. Lymphatic filariasis (Brugia malayi) is the etiologic agent of zoonosis of both humans and animals and is mainly distributed in east and south-east Asia. There are two types of lymphatic filariasis, periodic B. malayi and Wuchereria bancrofti. About 1.39 millions of infected individuals are found in China. [5] Controlling and eliminating lymphatic filariasis will require further research of preventative measures and implementation.

Current research in filariasis prevention and treatment is being performed with respect to vaccine development. Some candidate protective Ag were identified by comparing antilarval antibody responses of immunized and infected animals. [6],[7],[8] Parasite is dependent on glycolysis for ATP production. The glycolytic enzyme glyceraldenyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glycolysis and therefore is either a potential target for anti-parasite drug development or a vaccine candidate. It has been well documented that GAPDH appears to be an archetypcal protein of limited excitement. However, independent studies from a number of different laboratories reported a variety of diverse biological properties of the GAPDH protein. As a membrane protein, GAPDH functions in endocytosis; in the cytoplasm, it is involved in the translational control of gene expression; in the nucleus, it functions in nuclear tRNA export, in DNA replication and in DNA repair. [9],[10] The enzyme of the glycolytic pathway constitutes an excellent target for the design of new anti-parasite agents. [11] It is a putative vaccine candidate against parasites. [12],[13],[14] This study reported that the BmGAPDH gene was cloned and constructed in expression vector in order to observe the immune responses elicited in BALB/c mice by a DNA vaccine. It provided the basis for developing filariasis gene DNA vaccine. [11],[15],[16]


 ~ Materials and Methods Top


Strain parasite periodic B. malayi was collected from Zunyi (Guizhou provice, China). Vectors pcDNA3.1 was kindly provided by Dr. Yinchang Zhu (Jiangsu Provincial Key Lab of Molecular Biology of Parasites, China). E. coli DH5α was preserved in our laboratory. All restriction enzymes, T 4 DNA ligase, gel recovery DNA extraction kit, pGEM-T vector were purchased from Promega Company (USA). Goat anti-mouse-IgG-horseradish-peroxidase conjugate was purchased from Tianxiangren Biotech (Guangzhou, China). INF-g ELISA test kit and IL-4 ELISA test kit were purchased from eBioscience Company (USA). CpG ODNs were designed according to Krieg et al. [17] 5´TCCATGACGTTCCTGACGTT?3-TCCATGACGTTCCTGACGTT-3´ and were synthesized by Shanghai Yinjun Biology Company.

Primers design

Based on a known BmGAPDH gene sequence (GenBank U18137), two oligonucleotide primers were designed using Oligo Promer Analysis Software (Primer Premier 5.0, Palo Alto, CA, USA) and were synthesized by Shanghai Boya Biology Company. The specific primers containing the digestion sites of BamH I and Xho I were as follows:

P1: 5´-CCGGATCCACCATGATTAACATTGACTAT-3´,

P2: 5´-CCCTCGAGTTAGGTTGCTGTAGCCATAT-3´.

RNA extraction and cDNA amplification

The larvae of periodic B. malayi were collected from the peritoneal cavity of jirds. BmGAPDH cDNA fragment was obtained by reverse transcriptase-polymerase chain reaction (RT-PCR) with total RNA extracted from the larvae of periodic B. malayi and used as the template of PCR.

PCR amplification of BmGAPDH gene

The reaction mixture was initially heated to 94°C for 3 min, followed by 33 cycles of amplification. Each cycle consisted of incubation at 94°C for 50 s, 55°C for 45 s and 72°C for 90 s, finally 72°C extended for 7 min. The PCR product was identified by 1% agarose gel electrophoresis.

Construction of pcDNA3.1-BmGAPDH eukaryotic expression vector

pGEM-T vector and the amplified BmGAPDH gene fragment were digested with the restriction endonucleases. The digested products were linked by T 4DNA ligase to form recombinant and then transformed into competent cell DH5α. A few single colonies growing on ampicillin were selected from LB plates. The recombination plasmids were identified by tool enzyme digestion, PCR amplification and sequencing. After purification, the target gene fragments were ligated with pcDNA3.1 to construct the recombinant plasmid pcDNA3.1-BmGAPDH. The recombinant was screened and identified using restriction enzyme digestion and PCR.

Immunization of mice with pcDNA3.1-BmGAPDH

Forty-eight BALB/c mice, female, weighing 20 ± 2 g (provided by the Medical Animal Center of Nantong University) were randomly divided into four groups: Normal control, pcDNA3.1 blank plasmid control, pcDNA3.1-BmGAPDH group and pcDNA3.1-BmGAPDH/CpG groups. pcDNA3.1 and pcDNA3.1-BmGAPDH were each diluted to l μg/1 μl with normal saline. Fifty microliters (0.5 mg/ml) bupivacaine was injected into mice through the muscles of the left leg before immunization. Three days later, the DNA was inoculated in the same place on the mice at a dosage of 100 μg. The immunization was done three times at 2-week interval. Control group animals were injected with pcDNA3.1 blank plasmid and normal saline respectively. tests were carried out at 2, 4 and 6 weeks after the third injection. The animal experiment was approved by the ethic committee of Nantong University.

Detection of target genes by RT-PCR

Four weeks after final injection, the muscle tissue of the immunized mice was collected to draw genomic DNA and detect target genes by RT-PCR.

Detection of specific antibodies using the Enzyme-linked immunosorbent assay

Blood samples were taken three times from each inoculated mice: Immediately before the first inoculated, 4 and 6 weeks after the inoculation. Sera were separated from these samples and stored at -80°C until use. For a standard ELISA, a solution containing 40 μg of the purified pcDNA3.1-BmGAPDH expression protein in 0.1 M bicarbonate buffer (pH 9.6) was pipetted into the wells of a polystyrene microtitre plate and left for 24 h at 4°C. Following incubation with a test serum for 1 h at 37°C, the wells were washed three times and filled with a goat anti-mouse-IgG-horseradish-peroxidase conjugate. Specific antibodies were measured by using ELISA.

Lymphocyte proliferation assay

BALB/c mice were immunized with pcDNA3.1-BmGAPDH and served as the source of spleen cells. Spleens were removed from mice two weeks and four weeks after the third immunization respectively. In the spleen lymphocytes of immunized mice, the stimulation index (SI) was measured by the MTT method. The optical densities at 570 nm were evaluated.

The detection of INF-g and IL-4

At 2, 4 and 6 weeks after the third injection, four mice were sacrificed and serum samples were harvested for each group. All blood samples were centrifuged at 3000 r/min for 10 min. and the separated sera were stored at -80°C until assay. The levels of INF-g and IL-4 were detected according to the instruction of ELISA kit.

Data analysis

Experimental data were expressed as mean±sd. A one-way analysis of variance was used, followed by Dunnet's test for multiple comparisons. A P<0.05 was considered statistically significant.


 ~ Results Top


Construction of pcDNA3.1-BmGAPDH expression vector

The constructed pcDNA3.1-BmGAPDH vector was identified by enzyme digestion and the results were shown in [Figure 1]. Two fragments were obtained after BamH I and Xho I digestion. The small fragment was about 1020 bp, which corresponded with the predicted position of the gene of interest, which was absent in the digestion of control vector. The homology was 99% in nucleotide acid of the BmGAPDH fragment compared with the BmGAPDH gene reported in GenBank, suggesting that the construction of pcDNA3.1-BmGAPDH eukaryotic expression vector was successful.
Figure 1: Enzyme digestion identifi cation of recombinant pcDNA3.1-BmGAPDH. Two fragments were obtained after BamH I and Xho I digestion. The small fragment was about 1020 bp, which corresponded with the predicted position of the gene of interest. Lane 1: BamH I and XhoI digestion of pcDNA3.1; Lanes 2, 4: Marker; Lane 3: BamH I and Xho I digestion of pcDNA3.1-BmGAPDH; Lane 5: PCR products of the BmGAPDH gene

Click here to view


Detection of BmGAPDH genes in the immunized mice

BmGAPDH gene in the injected muscle of the immunized mice was detected by RT-PCR. There were positive results in the experimental group. PCR product showed the same size as the BmGAPDH gene [Figure 2]. The result showed that the recombinant pcDNA3-BmGAPDH was expressed in the immunized mice.
Figure 2: BmGAPDH gene detection by PCR in muscle tissue of mice vaccinated with recombinant plasmid. BmGAPDH gene in the injected muscle of the immunized mice was detected by RT-PCR. The result showed that the recombinant pcDNA3-BmGAPDH was expressed in the immunized mice. Lane 1: Marker; Lane 2: PCR product with BmGAPDH cDNA as a template; Lane 3: RT-PCR amplifi cation product

Click here to view


Detection of serum antibody titre in vaccinated mice

When pcDNA3.1-BmGAPDH protein was checked by western blotting, one specific band at 43 kDa was revealed. The protein preparation was therefore assumed to be quite pure and the target antigen. In the standard ELISA, the post-challenge sera from the mice immunized with the DNA vaccine had specific antibody titres of 1:1600 to 1:6400, and the highest titre was observed in the mice that were inoculated using pcDNA3.1-BmGAPDH/CpG at 6 weeks later [Table 1].
Table 1: Serum antibody titre in vaccinated mice detected by ELISA

Click here to view


Lymphocyte proliferation responses

Two weeks after the last immunization, the spleens of the mice were obviously enlarged. In the spleen lymphocytes of immunized mice, stimulation index (SI) was higher in the pcDNA3-BmGAPDH group than in the control group and it was substantially elevated at the fourth week (P<0.05), but lower than that of the pcDNA3-BmGAPDH/CpG-immunized group [Table 2].
Table 2: Lymphocyte proliferate response in vaccinated mice detected by MTT assay (A570 nm)

Click here to view


Detection of INF-g level in immunized mice

Serum INF-g level in the pcDNA3-BmGAPDH group as compared with control groups started to increases at the second week after the last vaccination, and it was substantially elevated at the fourth week and reached a peak at the sixth week. Significant difference were noted in INF-g level between pcDNA3-BmGAPDH/CpG group and control groups (P<0.01) [Table 3]. The results suggested that pcDNA3.1-BmGAPDH markedly stimulated the secretion of INF-g in immunized mice and with CpG, INF-g level was quickly increased after the sixth week particularly.
Table 3: IFN-ã level in serum of mice during immunization (pg/ml)

Click here to view


Detection of IL-4 level in immunized mice

Serum IL-4 level in pcDNA3-BmGAPDH group at different time points showed changes other than INF-g. It started to increase at the fourth week and further increased with time and peaked at the sixth week. When CpG was added, IL-4 level in the pcDNA3-BmGAPDH/CpG group decreased as compared with that in the pcDNA3-BmGAPDH group [Table 4]. No significant difference was found in IL-4 level between pcDNA3-BmGAPDH/CpG group and control groups at the fourth week (P>0.05).
Table 4: IL-4 Level in serum of mice during immunization (pg/ml)

Click here to view



 ~ Discussion Top


In this study, we amplified and cloned the GAPDH gene of periodic B. malayi, and used the gene to induce high-titre antibody responses and the proliferation of spleen lymphocytes and promotes the excretion of INF-γγ and IL-4 in immunized mice.

Some studies have shown that cytokines play a pivotal role in coordination and regulation of immune responses. Cytokines, such as INF-γ, IL-2, IL-12 and TNF-α, which were secreted by Th1 cells, could enhance the cytotoxicity of killer cells and cell-mediated immune response. Cytokines, such as IL-4, IL-5, IL-6, IL-10, which were secreted by Th2 cells, could promote the formation of antibodies and mediate humoral immune responses. [18] Under normal circumstances, Th1 and Th2 cells could regulate each other and thereby maintain normal immunity. [19],[20] In this study, cytokines detecting analysis showed that the level of INF-γ significantly increased 2 weeks after last vaccination in the experimental group and the level of IL-4 showed no significant difference as compared with two control groups. It was suggested that the recombinant pcDNA3.1-BmGAPDH mainly induced potent Th1 immune responses.

Recent work has revealed that CpG is currently attracting attention as an effective and safe vaccine adjuvant to prevent from microbial infections. [21] Synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs directly stimulate B cells and plasmacytoid dendritic cell (pDCs), thereby promoting the production of Th1 and proinflammatory cytokines and the maturation/activation of professional antigen-presenting cells. [22],[23] These activities enable CpG ODNs to act as immune adjuvants, accelerating and boosting antigen-specific immune responses by 5- to 500-fold. The CpG motifs present in bacterial DNA plasmids may contribute to the immunogenicity of DNA vaccines. [24],[25],[26] We found that CpG could increase the secretion of INF-g and inhibit the secretion of IL-4 in immunized mice. This finding indicates that CpG ODNs could enhance vaccine-induced cellular immune responses as adjuvants.

The need for a lymphatic filariasis vaccine for complete eradication disease is imperative. We have found in this study that the GAPDH gene of periodic B. malayi induces high-titre antibody responses and the proliferation of spleen lymphocytes and promotes the excretion of INF-gamma and IL-4 in immunized mice, which is a sign of enhanced systemic immune response. Our results also suggest that in order to induce protective immune responses, pcDNA3.1-BmGAPDH has to be combined with adjuvant to reinforce its immunogenicity. This is also the direction for future investigation.


 ~ Acknowledgment Top


This work was supported by the Social Progression Fund of Jiangsu Province (BS2006522).

 
 ~ References Top

1.Ottesen EA, Duke BO, Karam M. Strategies and tools for the control/elimination of lymphatic filariasis. Bull World Health Organ 1997;75:491-503.  Back to cited text no. 1
    
2.World Health Organization. The world health report. Geneva: World Health Organization; 1995. p. 3.  Back to cited text no. 2
    
3.World Health Organization. Report of the second meeting of global alliance to eliminate lymphatic filariasis. The secretariat of the Global Alliance to Eliminate Lymphatic Filariasis. Geneva: World Health Organization; 2002. p. 10-25.  Back to cited text no. 3
    
4.World Health Organization. Monitoring and epidemiological assessment of the programme to eliminate lymphatic filariasis at implementation level. Geneva: WHO/CDS/CPE/CEE; 2005. p. 50.  Back to cited text no. 4
    
5.He LY. Policy making and organization in managing tropical diseases in China. Chin Med J 2001;114:769-71.  Back to cited text no. 5
    
6.Weil GJ, Li BW, Liftis F, Chandrashekar R. Brugia malayi: Antibody responses to larval antigens in infected and immunized jilds. Exp Parasitol 1992;74:315-9.  Back to cited text no. 6
    
7.Li BW. Chandrashekar R, Weil G.J. Vaccination with recombinant filarial paramyosin induced partial immunity to Brugia malayi infection in jirds. J Immunol 1993;150:1881-5.  Back to cited text no. 7
    
8.Wang SH, Zheng HJ, Dissanayake S, Cheng WF, Tao ZH, Lin SZ, et al. Evaluation of recombinant chitinase and SXP1 antigens as antimicrofilaial vaccines. Am J Trop Med Hyg 1997;56:474-81.  Back to cited text no. 8
    
9.Sirover MA. Role of the glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase, in normal cell function and in cell pathology. J Cell Biochem 1997;66:133-40.  Back to cited text no. 9
    
10.Krynetski EY, Krynetskaia NF, Bianchi ME, Evans WE. A nuclear protein complex containing high mobility group proteins B1 and B2, heat shock cognate protein 70, ERp60, and glyceraldehyde-3-phosphate dehydrogenase is involved in the cytotoxic response to DNA modified by incorporation of anticancer nucleoside analogues. Cancer Res 2003;63:100-6.  Back to cited text no. 10
    
11.Akinyi S, Gaona J, Meyer EV, Barnwell JW, Galinski MR, Corredor V. Phylogenetic and structural information on glyceraldehyde-3-phosphate dehydrogenase (G3PDH) in Plasmodium provides functional insights. Infect Genet EVol 2008;8:205-12.  Back to cited text no. 11
    
12.Waine GJ, Becker M, Yang W, Kalinna B, McManus DP. Cloning molecular characterization, and functional activity of Schistosoma japonicum glyceraldehyde-3-phosphate dehydrogenase, a putative vaccine candidate against schistosomiasis japonica. Infect Immun 1993;61:4716-20.  Back to cited text no. 12
    
13.Argiro L, Kohlstadt S, Henri S, Dessein H, Matabiau V, Paris P, et al. Identification of a candidate vaccine peptide on the 37 kDa Schistosoma mansoni GAPDH. Vaccine 2000;18:2039-48.  Back to cited text no. 13
    
14.Singh S, Malik BK, Sharma DK. Molecular modeling and docking analysis of Entamoeba histolytica glyceraldehyde-3 phosphate dehydrogenase, a potential target enzyme for anti-protozoal drug development. Chem Biol Drug Des 2008;71:554-62.  Back to cited text no. 14
    
15.Argiro L, Doerig C, Liabeuf S, Bourgois AJ, Romette L. Production of Sm37-GAPDH, a major therapeutical target in human schistosomiasis. Biotechnol Bioeng 2000;68:136-41.  Back to cited text no. 15
    
16.Yang HW, Yong TS, Lee JH. Characterization of two glyceraldehydes-3-phosphate dehydrogenase genes in Giardia lamblia. Parasitol Res 2002;88:646-50.  Back to cited text no. 16
    
17.Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546-9.  Back to cited text no. 17
    
18.Babu S, Ganley LM, Klei TR, Shultz LD, Rajan TV. Role of gamma interferon and interleukin-4 in host defense against the human filarial parasite Brugia malayi. Infect Immun 2000;68:3034-5.  Back to cited text no. 18
    
19.Mosmann TR, Cherwinski H, Bond MW, Giedlin MA, Coffman RL. Two types of murine helper T cell clones. 1. Definition according to profiles of lymphokine activities and secreted proteins. Immunol 1986;136:2348-57.  Back to cited text no. 19
    
20.Koh YY, Park Y, Lee HJ. Levers of interleukin-2, interferon-gamma, and interleukin-4 in bronchoalveolar lavage fluid from patients with Mycoplasma pneumonia: Implication of tendency toward increased immunoglobulin E production. Pediatr J 2001;107:39-43.  Back to cited text no. 20
    
21.Lipford GB, Bauer M, Blank C, Reiter R, Wagner H, Heeg K. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: A new class of vaccine adjuvants. Eur Immunol 1997;27:2340-4.  Back to cited text no. 21
    
22.Cowdery JS, Chace JH, Yi AK, Krieg AM. Bacterial DNA induces NK cells to produce IFN-gamma in vivo and increases the toxicity of lipopolysaccharides. Immunol 1996;156:4570-5.  Back to cited text no. 22
    
23.Chace JH, Hooker NA, Mildenstein KL, Krieg AM, Cowdery JS. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12. Clin Immunol Immunopathol 1997;84:185-93.  Back to cited text no. 23
    
24.Sato Y, Roman M, Tighe H, Lee D, Corr M, Nguyen MD, et al. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 1996;273:352-4.  Back to cited text no. 24
    
25.Klinman DM. Adjuvant activity of CpG oligodeoxynucleotides. Int Rev Immunol 2006;25:135-54.  Back to cited text no. 25
    
26.Somroop S, Tongtawe P, Chaisri U, Tapchaisri P, Chongsa-nguan M, Srimanote P, et al. Traffic of antibody-secreting cells after immunization with a liposome-associated, CPG- ODN-adjuvanted oral cholera vaccine. Asian Pac J Allergy Immunol 2006;24:229-38.  Back to cited text no. 26
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
Print this article  Email this article
 

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04