Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 55 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (802 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Acknowledgment
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed1112    
    Printed47    
    Emailed1    
    PDF Downloaded95    
    Comments [Add]    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2012  |  Volume : 30  |  Issue : 2  |  Page : 159-164
 

The non-association of Panton-Valentine leukocidin and mecA genes in the genome of Staphylococcus aureus from hospitals in South Western Nigeria


Department of Biomedical Sciences, College of Health Sciences, LadokeAkintola University of Technology, Osogbo Campus, Nigeria

Date of Submission08-Sep-2011
Date of Acceptance08-Jan-2012
Date of Web Publication28-May-2012

Correspondence Address:
O A Terry Alli
Department of Biomedical Sciences, College of Health Sciences, LadokeAkintola University of Technology, Osogbo Campus
Nigeria
Login to access the Email id


DOI: 10.4103/0255-0857.96675

Get Permissions

 ~ Abstract 

Purpose: Virulence genes play important roles in pathogenesis of infections caused by S. aureus. The aim of this study was to determine the prevalence of PVL, eta and mecA genes in S. aureus isolated from patients in South-Western Nigeria. Materials and Methods: In this study, a total of 116 S. aureus isolates from the clinical specimens submitted to laboratories in tertiary hospitals in the South Western Nigeria were used. Antibiotic susceptibility test was carried out to determine the susceptibility pattern of the isolates using multiple antibiotics disc. Minimum inhibitory concentration (MIC) was also carried out to determine the degree of resistant of the isolates to methicillin. PCR was used to screen for the presence of PVL, eta, and mecAgenes. Results:mecA gene was detected in 48 (41.4%) of 116 strains of S. aureus. The MIC 50 and MIC 90 for mecA negative strains were 1 and 8 μg/ml, respectively while the MIC 50 and MIC 90 for mecA positive were >256 μg/ml. Twenty eight (24.1%) of 116 isolates were PVL gene positive with none of them mecA+. The prevalence of community acquired MRSA (CA-MRSA) was estimated to be 6.9% using molecular techniques. No localization of mecA gene and PVL gene on the genome of the entire S. aureus strains studied. Site of isolation of organism /specimen type was found to be associated with the prevalence of PVL+ and mecA+ S. aureus (P< 0.01). Conclusion: This study concludes that the PVL+ MRSA is rare and the prevalence of CA-MRSA is low in South-Western, Nigeria.


Keywords: mecA, molecular epidemiology, methicillin-resistant S. aureus, Nigeria, panton-valentine leukocidin


How to cite this article:
Terry Alli O A, Ogbolu D O, Mustapha J O, Akinbami R, Ajayi A O. The non-association of Panton-Valentine leukocidin and mecA genes in the genome of Staphylococcus aureus from hospitals in South Western Nigeria. Indian J Med Microbiol 2012;30:159-64

How to cite this URL:
Terry Alli O A, Ogbolu D O, Mustapha J O, Akinbami R, Ajayi A O. The non-association of Panton-Valentine leukocidin and mecA genes in the genome of Staphylococcus aureus from hospitals in South Western Nigeria. Indian J Med Microbiol [serial online] 2012 [cited 2013 May 18];30:159-64. Available from: http://www.ijmm.org/text.asp?2012/30/2/159/96675



 ~ Introduction Top


Staphylococcal infections constitute one of the most important infections in the hospital and community settings. The infections range from mild infections such as boils to life-threatening infections such as pneumonia. The treatment of Staphylococcus aureus Scientific Name Search  infections is compounded with the advent of methicillin-resistant S. aureus (MRSA) in 1961 with the attendance effect of multiple antibiotics resistant. MRSA has been reported all over the world [1],[2] and the prevalence is on the increase in Nigeria especially South Western Nigeria which has been shown to be home for multiple antibiotics resistant organisms. [3],[4] S. aureus is armed with virulence genes some of which have been shown to play important roles in pathogenesis of staphylococcal infection and immune avoidance in human hosts. [5] For example, the presence of the PVL gene in MRSA isolates from different parts of the world has been linked to community associated MRSA (CA-MRSA). [6],[7],[8] Information on the prevalence of CA-MRSA and the distribution of the PVL gene cum antibiotic resistance profile of S. aureus are very scanty in South Western, Nigeria.

The study was aimed at determining the relationship between mecA gene and virulence genes such as PVL gene on S. aureus epidemiology using the polymerase chain reaction technique. The objectives of the study were to (i) to determine antibiotic susceptibility patterns of S. aureus isolated within the period of study, (ii) to determine the prevalence of MRSA by detection of the mecA gene by polymerase chain reaction, (iii) to group the MRSA isolates into community and hospital acquired MRSA genetically and (iv) to determine the prevalence of the PVL gene in S. aureus isolates.


 ~ Materials and Methods Top


Organisms isolation and identification

One hundred and sixteen non-duplicated strainsof S. aureus isolated from the specimen submitted to two diagnostic laboratories in South Western Nigeria were used for this study. Demographic data such as sex, age, and site of isolation of specimen were collected from the requisition forms sent along with the clinical samples for microscopy, culture, and sensitivity from patients with different types of infections. The isolates were Gram stained to ensure that they were Gram-positive cocci. Biochemical tests such as catalase and coagulase tests were carried out to confirm the organisms as S.aureus. All the S.aureus isolates were stored at 4°C on Mueller Hinton (MH) agar slope until they were ready to use.

Antimicrobial disc susceptibility testing

The isolates were sub-cultured onto 6% salt agar and incubated at 37°C for 24 h to ensure that the isolates were pure isolates of S.aureus. The antimicrobial disc susceptibility testing was performed on Mueller Hinton agar. Gram-positive multiple antibiotic disc containing erythromycin (15 μg), cloxacillin (1 μg), tetracycline (10 μg), gentamicin (10 μg), amoxicillin-clavulanic acid (30 μg) were used. Also single antibiotic discs such as vancomycin (30 μg), pefloxacin (5 μg), ceftazidime (30 μg) and linezolid (30 μg) were used to determine the susceptibility pattern of the isolates. The susceptibility test was carried out as described previously. [4] Oxford S. aureus (NCTC 6571) was used as a control strain.

Minimum inhibitory concentration

Different clinical isolates of S. aureus with turbidity equivalent to 0.5 McFarland standard were subjected to different concentrations of methicillin from 0.125 to 512 μg/ml in MH broth. Three controls were set up: positive control (containing MH broth and ATCC 25923 strain of S. aureus), negative control (containing MH broth and the antibiotic), and sterility control (containing only MH broth). The tubes were incubated at 35°C for 24 h. After incubation, each tube was observed for microbial growth indicated by turbidity. The last tubes in dilution series that did not demonstrate microbial growth corresponds to the minimum inhibitory concentration of the antimicrobial agent.

DNA Extraction and PCR for detection of the mecA gene

DNA was extracted from 500 μl overnight Muller Hinton broth using lysostaphin (Sigma Aldrich, UK) and lysozyme (Sigma-Aldrich, UK) to digest the cell wall as described before. [9] PCR for themecA gene was carried out on all the strains as previously described. [4],[10] Positive control (MRSA DNA) and negative control DNA from NCTC 6571 (Oxford S. aureus) were included in each batch of PCR run. A successful amplification of the mecA gene would be indicated by 533 bp. Sequencing of the PCR products to confirm 533 bpmecA gene amplification was done.

PCR for detection of PVL gene

PCR was carried out to detect the presence of the virulence gene usinga primer pair previously described: [11] Luk-PV-1 5with sequence ATC ATT AGG TAA AAT GTC TGG ACA TGA TCC A and Luk-PV-2 5 with sequence GCA TCA AST GTA TTG GAT AGC AAA AGC representing forward and backward primers, respectively. Each primer had a concentration of 1 μM while the Taq mix made up of the following: 10 mM of MgCl 2 , 0.2 mM of dNTP mix and 1 U of Taq polymerase (NEB, USA). For detection of PVL gene, amplification was carried out with denaturation at 94°C for 30 sec, annealing at 55°C for 30 s and extension at 72°C for 1 min for 35 cycles of amplification. The expected product size was 433 bp.

PCR for detection of eta gene detection

PCR to detect the presence of eta gene was carried on the DNA extract using previously described primers pair [12] which included ETA 1with sequence CTAGTGCATTTGTTATCCAA and ETA 2 with sequence TGCATTGACACCATAGTACT representing forward and backward primers, respectively. For detection of eta gene, amplification was carried out with denaturation at 94°C for 30 sec, annealing at 55°C for 30 s and extension at 72°C for 1 min for 35 cycles of amplification. The expected product size was 119bp.

Grouping of MRSA into community and hospital acquired MRSA

MRSA isolates were grouped into community and hospital acquired MRSA by PCR technology as described before. [13] Briefly, three sets of primers previously described before [14] were used: MW0042, MW0043, and MW0047. The DNA was amplified with an initial denaturation temperature of 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 1 min, annealing temperature of 54°C for 30 sec, followed by extension at 72°C for 1 min. All the primers used above were synthesized by Invitrogen, UK and supplied by BDSL, Scotland, UK.

Statistics analysis

Data were analysed using statistical package within the Microsoft Excel and Epi-info software from Centre for Disease control and prevention, USA. Chi square test and t-test were used to determine the statistical significance. The P value less than 0.05 was considered to be significant.


 ~ Results Top


Among the 116 S. aureus isolates, 48 (41.4%) isolates were collected from tertiary hospital 2, while 68 (58.6%) isolates were from tertiary hospital 1. Catalase and coagulase positivities were used to confirm the S. aureus isolates.

Antimicrobial susceptibility testing done on the 116 isolates showed that they were all resistant to amoxicillin-clavulanic acid and sensitive to vancomycin and linezolid [Table 1]. Multiple antibiotic-resistant index was calculated for each strain to determine the level of multiple antibiotic resistant in this study. The average MAR index was found to be 0.49±0.22, an indication of multiple antibiotics resistant nature of the isolates in this study.
Table 1: Antibiotics susceptibility testing pattern of S. aureus

Click here to view


PCR was performed on 116 isolates to screen for a gene that coded for methicillin resistance phenotype (mecA). Forty-eight (41.4%) of the isolates were confirmed to be MRSA by demonstrating the presence of the mecA gene as shown by the successful application of 533 bp of part of the mecA gene [Figure 1]. The 533 bp product was confirmed after sequencing to be part of the mecA gene. Of the 116 isolates, 12 (25%) of the isolates from tertiary hospital 2 possessed the mecAgene, while 36 (52.9%) of the isolates from tertiary hospital 1 possessed themecA gene. There was a statistical significant difference between prevalence of the mecA gene in S. aureus at tertiary hospital 2 and tertiary hospital 1 (Chi square = 7.94; P< 0.05).The distribution of the mecA gene according to gender showed that 20 (41.7%) of the 48 MRSA isolates from males were positive for the mecA gene while the remaining 28 (58.3%) were from females. Gender was found to be associated with the prevalence of the mecA gene in South western Nigeria (Chi square = 5.14; P< 0.05). [Figure 2] shows proportional distribution within different age groups. Age group 46-60 years recorded highest proportional distribution for the mecA gene in S. aureus while the lowest distribution was recorded for the 31-45 age group. Age was found to be associated with the prevalence of the mecA gene in S. aureus isolated from patients in this study (Chi square = 18.30; P< 0.01). With respect to the site of isolation or specimen type, the mecA gene in S. aureus was frequently isolated from urethral swabs (100%) followed by urine (75%); with the wound swab posted the least proportionally distributed mecA-positive S. aureus (21.4%) [Table 2]. Site of isolation/specimen type was found to be associated with the prevalence of mecA-positive S. aureus isolation (Chi square = 24.11; P< 0.001).
Figure 1: PCR for detection of the mecA genein S. aureus isolates from South Western Nigeria. Representative agarose gel electrophoresis of PCR products obtained after PCR for the mecA gene. Positive PCR product is indicated by the presence of 533 bpamplicons. Lane 10: negative control; Lane 11: positive control; Lane M: 100 bp DNA molecular weight size marker.

Click here to view
Figure 2: Distribution of mecA and PVL genes in S. aureus according to different age groups in South-Western Nigeria

Click here to view
Table 2: Distribution of mecA and PVL genes according to specimen

Click here to view


MIC was done in order to determine the level of resistance in both the mecA positive strains and mecA negative strains. The MIC 50 and MIC 90 of the mecA negative were 1 μg/ml and 8 μg/ml, respectively while that of mecA positive strains were >256 μg/ml (MIC reference value for susceptible = ≤8; for resistant = ≥16). There was statistical significant difference between the level of resistance to methicillin between mecA-positive strains and mecA-negative strains (t-test, P< 0.01). The average MAR indexes for mecA-positive and -negative strains were found to be 0.66 and 0.32, respectively.

Virulence genes play very important roles in bacterial pathogenesis [5] and S. aureus could not be an exception to this. It was in view of this that some of the virulence genes (PVL, exfoliatin toxin A, and toxic shock syndrome) were screened for with the hope one of the virulence genes could be incriminated in S. aureus infections. PCR was performed on all the isolates to detect PVL gene. In the entire S. aureus isolates examined, 28 (24.1%) of the 116 isolates possessed the PVL gene as shown by the successful amplification of 433 bp product that was specific for part of the PVL gene [Figure 3]. Twenty (29.4%) of the total 68 isolates from tertiary hospital 1 possessed the PVL gene, while 8 (16.7%) of the total isolates (n=40) from tertiary hospital 2 possessed PVL gene. Location of the hospitals in this study was found not to influence the prevalence of PVL+S. aureus infections as this was not statistically significant (Chi square = 1.85; P> 0.05). Twenty four (85.7%) of the PVL+ S. aureus isolates were from male patients while 4 (14.3%) were from female patients. Gender difference had significantly contributed to the prevalence of PVL+ S. aureus infection in this study (Chi square = 12.34; P< 0.01). Furthermore, 12(42.9%) of the PVL-positive S. aureusstrains were isolated from patients within the age group 0-15 years [Figure 2], with the age group 46-60 recorded the least proportional distribution of 0%. Wound swab recorded the highest isolation rate for PVL+ S. aureus (42.9%) while urine, urethral, blood and aspirate recorded the lowest isolation rate [Table 2]. Specimen type was found to be associated with the prevalence of PVL+ S. aureus infection (Chi square = 32.42; P< 0.01). None of the mecA-positive S. aureus harboured the PVL gene indicating non-association of mecA with PVL gene. Exfoliatin toxin A and toxic shock syndrome genes were not detected in all the clinical strains obtained from this study suggesting that these genes are very rare amongst the S. aureus isolates in this part of the world. The prevalence of mecA positive S. aureus or methicillin resistant S. aureus and PVL positive S. aureus were 41.4% and 24.1%, respectively.
Figure 3: PCR for detection of PVL genein S. aureus isolates from South-western Nigeria. Representative agarose gel electrophoresis PCR products obtained after PCR for the PVL gene. Positive PCR
product for PVL gene is indicated by 433 bpamplicons. Lane 13: negative control; Lane 14: positive control; Lane M: 100 bp DNA molecular weight size marker


Click here to view


All the 48 mecA-positive isolates were grouped into CA-MRSA and HA-MRSA using primers for MW0042, MW0043, and MW0047. MW0042, MW0043, and MW0047 are genes specific for CA-MRSA. Out of the 48 isolates screened; 4 (8.3%) isolates were positive for the three primers and 4 (8.3%) positive for only MW0047. This result showed that 8 (16.6%) of the 48 MRSA isolates were CA-MRSA or type IV SCCmec and compared to the total number of S. aureus it showed that 6.9% of the total S. aureus isolates were CA-MRSA. All the positive CA-MRSA isolates were obtained from tertiary hospital 1.


 ~ Discussion Top


Bacterial genetic mechanisms are capable of enhancing virulence and promoting emergence of new epidemics by acquisition of this gene from the external environment. Antibiotic resistance is another factor in bacterial pathogen resurgence. The combination of virulence gene and antibiotic resistance can lead to emergence of "superbug." Constant surveillance of the pathogens isolated from patients with infections for virulence genes and antibiotic resistance genes can help us in making appropriate decision in the treatment of life threatening infections such as septicaemia and pneumonia. The Panton-Valentine Leukocidin (PVL) is a bicomponentcytotoxin that is preferentially linked to furuncles, cutaneous abscess and severe necrotic skin infections. [11] It is very interesting to know that in this study there was no co-localization of PVL and mecA genes on the genome of all the S. aureus strains examined i.e. it was only possible to have PVL or mecA genes but not both genes on the chromosome of the S. aureus isolates from clinical specimens. This is in agreement with study carried by Okonet al., [14] where they found no PVL+ MRSA in 96 strains of S. aureus examined. PVL gene localization within genome of MRSA strains has been reported in some studies [15] and in fact this gene has been used as a marker of community acquired MRSA (CA-MRSA). There is a belief that the reason the people in the community get infected with MRSA is because of the high virulence nature of the MRSA acquired in the community due to the presence of PVL gene (a known virulence gene). The inability to associate PVL with MRSA prompted our study to do a general grouping of the MRSA isolates into two groups - CA-MRSA and HA-MRSA using the primers used by Memmiet al., [13] The prevalence of CA-MRSA in South Western Nigeria was found to be 6.9% and none of the CA-MRSA had PVL gene in this study. A similar study in Ibadan, Nigeria [8] reported the isolation of CA-MRSA with the presence of PVL gene in S.aureus from Ibadan. Ghebremedhinet al. [8] reported the 47% prevalence rate for CA-MRSA while reporting 20.23% prevalence rate for MRSA which contradicts what we obtained here. Although there is a possibility of mistake in the figure because it is not possible for CA-MRSA prevalence rate to almost double the general MRSA prevalence rate reported which comprised of the CA-MRSA and HA-MRSA. The 20.23% prevalence rate for MRSA reported is in agreement with a similar study carried by Alliet al., [4] where they reported the 22.2% prevalence rate for MRSA. A year difference in that study and our present study has shown an increase to the 41.4% prevalence rate for MRSA in South-Western Nigeria; tertiary hospital 2 recorded 25.9% suggesting MRSA has not been brought under control. The recent epidemiological analysis of S. aureusisolates using molecular techniques have provided important baseline information on the emergence of antibiotic resistant S. aureus, and the diversity of hospital and community-acquired MRSA in Nigeria. In a study by Memmiet al., [13] the prevalence of CA-MRSA was put at 18% which is not in agreement with 6.9% observed from our study. Since there was low prevalence of CA-MRSA in our study, it showed that the prevalence of HA-MRSA was high. This means there was high number of MRSA infection in the hospital settings. It is much easier to control MRSA in hospital settings than the community like ours where antibiotics misuse is common. The high prevalence of methicillin resistant S. aureusin our teaching hospitals indicates there is need to take control of MRSA infection very seriously as they do in developed countries. The simplicity in molecular grouping of MRSA used in this study has provided easier way of monitoring the epidemiology of MRSA especially CA-MRSA which can pose a serious threat in low resource countries like Nigeria.

The worrisome part of the facts emerging from this study is the multiple antibiotics resistant nature of the MRSA which had an average MAR index of 0.63. There was significant difference in MAR index between methicillin sensitive S. aureus (MSSA) (0.32) and MRSA (0.66) (P< 0.01). This is expected because a majority of MRSA strains are known to develop resistance to two or more antibiotics.Studies [16] have shown that an MAR index higher than 0.2 is an indication of isolates originating from an environment where antibiotics are often used. This assertion cannot be ruled out because a majority of the MRSA strains were hospital-acquired microorganisms.

Association was found between prevalence of PVL+ S. aureus and the sites of isolation of organism/clinical specimen type (P< 0.01) in our study while no association was found between prevalence of PVL+ S. aureus and age groups. Although the detection of the lukPVgene and its association in CA-MRSA is controversial, it is generally accepted as a common virulence marker in community-associated MRSA. [7] Association has been found between the presence of the PVL gene in S. aureusand cutaneous infections. [11] In our study, there was association between site of collection of specimen / specimen type and the prevalence of PVL+ S. aureus; majority of the PVL+ S. aureus was recovered from wound swabs which is in line with the observation made by Okonet al. [14]

In this study, 116 S. aureus isolates were studied, 48 (41.4%) were MRSA and 68 (58.6%) were MSSA. Also, PVL+ MRSA was not isolated in this study and PVL+ MSSA rate of 41.2% was observed which is far higher than what was obtained in England. [17] Furthermore, 28 (24.1%) isolates of the total isolates were positive for the S. aureus PVL geneby PCR, which was lower than what was observed in the study carried out in France by Duruptet al., [18] and in Nigeria by Okonet al. [14] No association was found between hospitals and prevalence of PVL+ S. aureus (P> 0.05), which is in contrast with prevalence of mecA+ S. aureus in this study. The only plausible explanation to difference in the prevalence of mecA+ S. aureus might have something to do with different antibiotic policies of the two hospitals (tertiary hospital 1 and tertiary hospital 2) which the present study is not able to unravel.

Exfoliative toxins (also known as "epidermolytic" toxins) are particularly interesting virulence factors of S. aureus. ET is divided into two serotypes, ETA and ETB. ETA is a heat-stable toxin, whereas ETB is heat labile. Our study concentrated on chromosomal genes because of gene stability; hence, we did not test for the presence of the etb gene in S. aureus. In a study carried out in Nigeria, out of 194 S. aureus isolates screened, 6 (3.1%) isolates possessed the etagene [19] which was higher than what was observed in our study. The inability to get eta positive or toxic shock syndrome positive S. aureus in our study may be due to the limited number of S. aureus isolates used in this study or general low prevalence of these virulence genes in S. aureus infections in Nigeria.

In conclusion, our analysis of isolates from South-Western Nigeria indicates a high number of PVL-positive MSSA isolates from wound specimens along with multidrug-resistant MRSA strains and low prevalence of CA-MRSA. Future studies may further elucidate possible epidemiological risk factors associated with the acquisition of CA-MRSA infections in this environment.


 ~ Acknowledgment Top


The molecular biology works were all carried out in the Molecular Biology Laboratory, Department of Biomedical Sciences, Ladoke Akintola University of Technology, Mercyland Campus, Osogbo. We would like to thank the Ex-Vice Chancellor (Professor B.B.A. Adeleke) and Management of Ladoke Akintola University of Technology for the establishment of the Molecular Biology Laboratory. We also acknowledge Mr Oyenike and the Medical Laboratory Scientists at the Department of Medical Microbiology, UCH Ibadan, OAUTHC Ife, and LTH Osogbo for their technical assistance and Prof R. A. Bakare for his support.

 
 ~ References Top

1.Hiramatsu K, Cui L, Kuroda M, Ito T. The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol 2001;9:486-93.  Back to cited text no. 1
    
2.Iwakawa K, Okuma K, Turnidge J. Dissemination of new methicillin resistant Staphylococcus aureus and molecular clones in the community. J ClinMicrobiol 2002;40:4289-94.  Back to cited text no. 2
    
3.Ogbolu DO, Daini OA, Ogunledun A, Alli AO, Webber MA. High levels of multidrug resistance in clinical isolates of Gram-negative pathogens from Nigeria. Int J Antimicrob Agents 2011;37:62-6.  Back to cited text no. 3
    
4.Alli O, Ogbolu D, Akorede E, Onemu O, Okanlawon B. Distribution of mecA gene amongst Staphylococcus aureus isolates from south western Nigeria. Afr J Biomed Res 2011;14:9-16.  Back to cited text no. 4
    
5.Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol 2005;3:948-58.  Back to cited text no. 5
    
6.Vandenesch F, Naimi T, Enright M, Lina G, Nimmo G, Heffernan H. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: Worldwide emergence. Emerg Infect Dis 2003;9:978-84.  Back to cited text no. 6
    
7.Said-Salim B, Mathema B, Braughton K, Davis S, Sinsimer D, Eisner W, et al. Differential distribution and expression of Panton-Valentine leucocidin among community-acquired methicillin-resistant Staphylococcus aureus strains. J ClinMicrobiol 2005;43:3373-9.  Back to cited text no. 7
    
8.Ghebremedhin B, Olugbosi MO, Raji AM, Layer F, Bakare RA, Konig B, et al. Emergence of a community-associated methicillin-resistant Staphylococcus aureus strain with a unique resistance profile in Southwest Nigeria. J ClinMicrobiol 2009;47:2975-80.  Back to cited text no. 8
    
9.Alli O, Akinloye O, Rowley D, Butcher P. A comparative assessment of ribosomal DNA polymorphisms in methicillin resistant Staphylococcus aureus (MRSA) epidemiology. Afr J Biomed Res 2007;10:117-25.  Back to cited text no. 9
    
10.Murakami K, Minamide W. PCR identification of Methicillin-Resistant Staphylococcus aureus. In: Persing D, Smith T, Tenover F, White T, editors. Diagnostic Molecular Microbiology: Principles and Applications. Washington, DC: ASM; 1993. p. 534-8.  Back to cited text no. 10
    
11.Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999;29:1128-32.  Back to cited text no. 11
    
12.Johnson W, Tyler S. PCR detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin-1 in Staphylococcus aureus. In: Persing D, Smith T, Tenover F, White T, editors. Diagnostic Molecular Microbiology: Principles and Applications. 1 st ed. Washington, DC: ASM; 1993. p. 294-9.  Back to cited text no. 12
    
13.Memmi G, Filipe SR, Pinho MG, Fu Z, Cheung A. Staphylococcus aureus PBP4 is essential for beta-lactam resistance in community-acquired methicillin-resistant strains. Antimicrob Agents Chemother 2008;52:3955-66.  Back to cited text no. 13
    
14.Okon KO, Basset P, Uba A, Lin J, Oyawoye B, Shittu AO, et al. Cooccurrence of predominant Panton-Valentine leukocidin-positive sequence type (ST) 152 and multidrug-resistant ST 241 Staphylococcus aureus clones in Nigerian hospitals. J ClinMicrobiol 2009;47:3000-3.  Back to cited text no. 14
    
15.Dufour P, Gillet Y, Bes M, Lina G, Vandenesch F, Floret D, et al. Community-acquired methicillin resistant Staphylococcus aureus infections in France: Emergence of a single clone that produces Panton-Valentine leukocidin. Clin Infect Dis 2002;35:819-24.  Back to cited text no. 15
    
16.Krumperman PH. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of foods. Appl Environ Microbiol 1983;46:165-70.  Back to cited text no. 16
    
17.Ellington MJ, Hope R, Ganner M, East C, Brick G, Kearns AM. Is Panton-Valentine leucocidin associated with the pathogenesis of Staphylococcus aureus bacteraemia in the UK? J AntimicrobChemother 2007;60:402-5.  Back to cited text no. 17
    
18.Durupt F, Mayor L, Bes M, Reverdy ME, Vandenesch F, Thomas L, et al. Prevalence of Staphylococcus aureus toxins and nasal carriage in furuncles and impetigo. Br J Dermatol 2007;157:1161-7.  Back to cited text no. 18
    
19.Adesida S, Boelens H, Babajide B, Kehinde A, Snijders S, van Leeuwen W, et al. Major epidemic clones of Staphylococcus aureus in Nigeria. Microb Drug Resist 2005;11:115-21.  Back to cited text no. 19
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
Print this article  Email this article
 

    

© 2004 - Indian Journal of Medical Microbiology
Published by Medknow

Online since April 2001, new site since 1st August '04