Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 157 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (1,340 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~ Introduction
 ~  Materials and Me...
 ~ Results
 ~ Discussion
 ~ Acknowledgement
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed4166    
    Printed233    
    Emailed7    
    PDF Downloaded269    
    Comments [Add]    
    Cited by others 3    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2011  |  Volume : 29  |  Issue : 3  |  Page : 262-268
 

Identification of plasmid-mediated quinolone resistance genes qnrA1, qnrB1 and aac(6')-1b-cr in a multiple drug-resistant isolate of Klebsiella pneumoniae from Chennai


1 Department of Biotechnology, Dr. M.G.R. Educational and Research Institute, Maduravoyal, Chennai - 600 095, India
2 Department of Microbiology, Government General Hospital, Chennai - 600 003, Tamil Nadu, India

Date of Submission09-May-2011
Date of Acceptance01-Jul-2011
Date of Web Publication17-Aug-2011

Correspondence Address:
R Vaidyanathan
Department of Biotechnology, Dr. M.G.R. Educational and Research Institute, Maduravoyal, Chennai - 600 095
India
Login to access the Email id

Source of Support: Council of Industrial and Scientifi c Research, India to Rama Vaidyanathan (No. 37(1385) 09/EMR-II (2009)), Conflict of Interest: None


DOI: 10.4103/0255-0857.83910

Rights and Permissions

 ~ Abstract 

Purpose: Resistance to fluoroquinolones, a commonly prescribed antimicrobial for Gram-negative and Gram-positive microorganisms, is of importance in therapy. The purpose of this study was to screen for the presence of Plasmid-Mediated Quinolone Resistance (PMQR) determinants in clinical isolates of Klebsiella pneumoniae. Materials and Methods: Extended-Spectrum Beta-Lactamase (ESBL) isolates of K. pneumoniae collected during October 2009 were screened by the antimicrobial susceptibility test. The plasmids from these isolates were analysed by specific Polymerase chain Reaction (PCR) for qnrA, qnrB and aac(6')-1b. The amplified products were sequenced to confirm the allele. Results: Our analysis showed that 61% out of the 23 ESBL K. pneumoniae isolates were resistant to ciprofloxacin and 56% to levofloxacin. The PMQR was demonstrated by transforming the plasmids from two isolates P12 and P13 into E. coli JM109. The PMQR gene qnrA was found in 16 isolates and qnrB in 11 isolates. The plasmid pKNMGR13 which conferred an minimum inhibitory concentration (MIC) of more than 240 ΅g/ml in sensitive E. coli was found to harbour the qnrA1 and qnrB1 allele. Furthermore, the gene aac(6')-1b-cr encoding a variant aminoglycoside 6'-N Acetyl transferase which confers resistance to fluoroquinolones was found in the same plasmid. Conclusions: Our report shows the prevalence of PMQR mediated by qnrA and qnrB in multidrug-resistant K. pneumoniae isolates from Chennai. A multidrug-resistant plasmid conferring high resistance to ciprofloxacin was found to harbour another PMQR gene, aac(6')-1b-cr mutant gene. This is the first report screening for PMQR in K. pneumoniae isolates from India.


Keywords: Aac(6′)-1b-cr, Klebsiella pneumoniae, plasmid-mediated quinolone resistance, qnrA, qnrB


How to cite this article:
Magesh H, Kamatchi C, Vaidyanathan R, Sumathi G. Identification of plasmid-mediated quinolone resistance genes qnrA1, qnrB1 and aac(6')-1b-cr in a multiple drug-resistant isolate of Klebsiella pneumoniae from Chennai. Indian J Med Microbiol 2011;29:262-8

How to cite this URL:
Magesh H, Kamatchi C, Vaidyanathan R, Sumathi G. Identification of plasmid-mediated quinolone resistance genes qnrA1, qnrB1 and aac(6')-1b-cr in a multiple drug-resistant isolate of Klebsiella pneumoniae from Chennai. Indian J Med Microbiol [serial online] 2011 [cited 2018 Sep 20];29:262-8. Available from: http://www.ijmm.org/text.asp?2011/29/3/262/83910



 ~ Introduction Top


Quinolones constitute an important group of antimicrobials active against Gram-negative and Gram-positive bacteria. [1] Fluoroquinolones are the third largest selling drug class with sales of US$ 7.1 billion, accounting for 17% of the world antibiotic market in 2009. [2] Since the introduction of fluoroquinolones for therapy in 1962, resistance of the Enterobacteriaceae to these agents has become common, widespread and generally non-clonal. [3] Quinolone resistance can be due to mutations in the chromosomal genes for the DNA gyrase and topoisomerase IV, the targets of quinolone action; and by changes in expression of efflux pumps and porins that control the accumulation of these agents inside the bacterial cell. [4] Plasmid-mediated quinolone resistance (PMQR) was first reported in 1988 in a fluoroquinolone-resistant strain of Klebsiella pneumoniae in Alabama, USA. [5] This gene encoding quinolone resistance, named qnrA1, belongs to a pentapeptide repeat family. Two other transferable quinolone resistance determinants have also been described, aac(60′)-Ib-cr which encodes a variant aminoglycoside acetyltransferase with two amino acid alterations allowing it to inactivate ciprofloxacin [6] and qepA genes which encode efflux pumps that extrude quinolones. [7]

The qnr genes show a high level of diversity. Five main types of the qnr genes, qnrA,[5] qnrB,[8] qnrC,[9] qnrS[10] and qnrD,[11] have been identified. The qnrB gene was identified first in an isolate of K. pneumoniae from South India, and subsequently has been found in isolates in the USA, Korea, Kuwait, France and Taiwan. [3],[8] The qnrA genes were also reported in K. pneumoniae from South Indian isolates in the same paper. [8]

Since the report of Jacoby et al., there has not been any screening for the prevalence of the qnr genes in K. pneumoniae isolates in India. In a study from our laboratory, we analysed 23 isolates of K. pneumoniae collected in October 2009 and found them to be Extended-Spectrum Beta-Lactamase (ESBL) isolates with plasmids containing different combinations of blaSHV , blaOXA-1 and blaCTX-M genes. Since ESBL isolates are frequently resistant to quinolones, and the plasmids containing ESBL genes also have the genes conferring quinolone resistance, we undertook this study to screen for qnr genes in these 23 ESBL isolates of K. pneumoniae collected in October 2009. This is the first report from India demonstrating plasmid-mediated quinolone resistance (PMQR) mediated by qnr genes and the aac(6')-1b-cr allele in K. pneumoniae.


 ~ Materials and Methods Top


Bacterial isolates

Twenty-three clinical isolates of K. pneumoniae collected from tertiary care hospitals during Oct 2009 were subjected to routine culture and antibiotic susceptibility testing.

Antimicrobial susceptibility testing

Antibiotic susceptibility testing was performed according to standard methods on Mueller Hilton agar (Himedia Laboratories Pvt. Ltd., Mumbai, India). The antibiotics Norfloxacin (10 μg disk-1, Himedia Laboratories Pvt. Ltd., Mumbai, India), Levofloxacin (5 μg disk- 1, Himedia Laboratories Pvt. Ltd., Mumbai, India) and Ciprofloxacin (5 μg disk-1 , Himedia Laboratories Pvt. Ltd., Mumbai, India) were used for antibiotic susceptibility screening. The results were interpreted as per the CLSI guidelines. [12] Minimum inhibitory concentration of Ciprofloxacin was determined by the HiComb TM E-Strip from Himedia Laboratories Pvt. Ltd., Mumbai, India, following the manufacturer's instructions.

PCR amplification and sequence analysis

Amplification of the qnrA, qnrB and qnrS genes was performed for all the K. pneumoniae isolates using the primer sets described in a previous report. [13] PCR experiments were carried out according to standard conditions (annealing temperature at 55°C [for qnrA], 60°C [for qnrB and qnrS] and extension 1 min at 72°C, 35 cycles) using primers synthesised by Eurofins Genomics India Pvt. Ltd, Bangalore, India. Taq DNA polymerase (Biotools, B and M Labs, Madrid, Spain) and dNTP (Cinna Gen Inc. Tehran, Iran) were used as per standard protocols. For detecting the aac(6')-1b, primers were chosen to amplify all known aac(6')-Ib variants. [14] The primers used were 5'-TTGCGATGCTCTATGAGTGGCTA-3' and 5'-CTCGAATGCCTGGCGTGTTT-3' which produce a 482-bp product. PCR conditions were 94°C for 45 s, 55°C for 45 s and 72°C for 45 s for 34 cycles. The aac(6')-Ib variants allele was identified by direct sequencing of the PCR product with primer 5' CGTCACTCCATACATTGCAA 3'.

DNA was prepared for the PCR reaction by suspending a single colony of the clinical isolate in 500 μl of sterile Millipore water in a 1.5 eppendorf tube, followed by boiling at 100°C for 5 minutes and centrifuged at 5,000 rpm for 10 minutes. [15] Two μl of supernatant was used as DNA source for the PCR reaction. PCR experiments were carried out according to conditions given. The PCR products were analysed on a 1.5% agarose gel (Himedia Laboratories Pvt. Ltd., Mumbai, India) and the DNA bands were visualised by staining with Ethidium Bromide (Himedia Laboratories Pvt. Ltd., Mumbai, India). The 100 bp DNA Marker from Medox Biotech India Pvt. Ltd., Chennai, India, was used for sizing the PCR bands. The PCR-amplified products were sequenced by SciGenom Labs Pvt. Ltd., Cochin, Kerala, India. The sequence from the chromatogram were analysed by BLAST and compared with known alleles to identify the correct allele.

Plasmid isolation and transformation

Plasmids from the clinical isolates of K. pneumoniae were isolated using HiPurA TM Plasmid DNA Mini and Midi prep purification Spin Kit (HiMedia Laboratories Pvt. Ltd., Mumbai, India). For transformation experiments, plasmid DNA was isolated from two fluoroquinolone isolates of K. pneumoniae (Isolate P12 and P13) and transformed into a recipient strain (E. coli JM109). E. coli JM109 is resistant to Nalidixic acid (Sigma-Aldrich Co., St. Louis, MO, USA) but sensitive to ciprofloxacin. The plasmid DNA was transformed into E. coli by electroporation using PEP TM (Personal Electroporation Pak Electroporator - BTX; Genetronics Inc) giving two electric pulses of 180 V at an interval of two seconds of each. The transformants were selected in LB agar (Himedia Laboratories Pvt. Ltd., Mumbai, India) containing Ciprofloxacin (Sigma-Aldrich Co., St. Louis, MO, USA) at a concentration of 1 μg/ml. These transformants were analysed further for antibiotic resistance pattern and PCR amplification.


 ~ Results Top


Fluoroquinolone resistance of Klebsiella pneumoniae Scientific Name Search  clinical isolates from Chennai

Clinical isolates of K. pneumoniae collected from Chennai in October 2009 were analysed for their resistance to the most commonly used fluoroquinolone antibiotics--ciprofloxacin and levofloxacin. It was found that 14 out of the 23 isolates (61%) of the ESBL isolates were resistant to ciprofloxacin, five out of 23 (22%) intermediately resistant and four (17%) were sensitive. The antibiotic levofloxacin was marginally better with 52% isolates resistant. The high resistance to fluoroquinolones is worrying and can compromise antimicrobial treatment.

Association between MIC to Ciprofloxacin and the presence of qnr genes

PMQR can be mediated by the qnr genes. In order to find out if these isolates harboured the qnrA and qnrB genes, a specific PCR was carried out from plasmids isolated from these isolates. In 16 out of 23 (70%) ESBL isolates, qnrA-specific PCR product [Figure 1]a was observed. In 11 isolates (48%), qnrB gene was observed [Figure 1]b. We were unable to amplify any product for the qnrS genes. Eight out of the 23 isolates (24%) had both qnrA and qnrB genes. In four isolates (12%), none of the qnr genes were present. The qnrA and qnrB amplified product from the isolate P13 was sequenced to confirm that it was the qnrA1 [Figure 2]: GenBank Acc. No. HQ675013.1 and qnrB1 [Figure 3]: GenBank Acc. No. HQ675012.1 allele, respectively.
Figure 1: Amplifi cation of qnrA and qnrB: Single colony PCR amplification of 628 bp qnrA gene (a) and 408 bp of qnrB gene (b) from the clinical isolates of Klebsiella pneumoniae in 1.5% agarose gel

Click here to view
Figure 2: Partial sequence of qnrA1 from pKNMGR13 (GenBank Accession Number HQ675013.1). The amino acid sequences from 12 to 212 are given. The amino acids which are variant and used to identify the qnrA alleles are given in bold

Click here to view
Figure 3: Partial sequence of qnrB1 from pKNMGR13 (GenBank Accession Number HQ675012.1). The amino acid sequences from 35 to 138 are given. The amino acids which are variant and used to identify the qnrB alleles are given in bold

Click here to view


In order to correlate the fluoroquinolone resistance in the isolates with the qnr gene determinants, the minimal inhibitory concentration of ciprofloxacin for 19 resistant isolates was determined [Table 1]. We found that two isolates showed MIC >240 μg/ml, while nine showed MIC >120 μg/ml. All the isolates which had an MIC >120 μg/ml were associated with either qnrA or qnrB or both genes. However, there were two isolates with an MIC of >60 μg/ml which were not associated with qnr genes. In addition, two fluoroquinolone-sensitive isolates harboured the qnr genes. Therefore, we wanted to find out if fluoroquinolone resistance was plasmid mediated and if there were other genes which could confer cumulative resistance.
Table 1: The MIC of ciprofl oxacin for Klebsiella pneumoniae isolates and the detection of qnrA and qnrB genes is shown

Click here to view


Transfer of quinolone resistance

Since fluoroquinolone resistance can be chromosomal, plasmid mediated or a combination of both, we wanted to find out if the resistance in these isolates was plasmid borne. We chose two isolates P12 and P13 which carried both qnrA and qnrB genes and an MIC >120 μg/ml for further studies. Plasmid DNA from these two isolates was isolated and transformed into E. coli JM109 by electroporation. The transformants were selected on ciprofloxacin (1 μg/ml). Plasmid isolated from the transformants was analysed by qnr-specific PCR. [Figure 4] shows the specific amplification of both qnrA and qnrB in the transformants.
Figure 4: PMQR-specifi c amplifi cation in E. coli transformants. (a) shows qnrA and qnrB gene-specifi c PCR on the E. coli JM109 transformants with the plasmids isolated from Klebsiella pneumoniae isolate P12 and P13. The E. coli JM109 transformants with the plasmid pKNMGRP12 is C12a and that with plasmid pKNMGRP13 is C13a. (b) shows the aac(6')-Ib gene-specifi c PCR on plasmids pKNMGRP12 and pKNMGRP13

Click here to view


Furthermore, the minimum inhibitory concentration of ciprofloxacin in the transformants was determined. It was found that the E. coli transformants with the plasmid either from the P12 or P13 K. pneumoniae isolate showed an MIC of >240 μg/ml [Figure 5]. The E. coli JM109 strain without the plasmids was sensitive to ciprofloxacin. This clearly shows that ciprofloxacin resistance is mediated by plasmids from these isolates. The transformants were also resistant to cefotaxime, a third-generation cephalosporin, suggesting that the ESBL resistance determinants may be carried in the transferred plasmid.
Figure 5: MIC of Ciprofl oxacin for E. coli JM109 and the transformants. Transformed colonies were tested for Ciprofloxacin MIC value by E-Strip Test. (a) Host E. coli JM109, (b) - The plasmid pKNMGR12 transformed in E. coli JM109 (c)- The plasmid pKNMGR13 transformed in E. coli JM109

Click here to view


Since the level of PMQR was high, we investigated whether any other quinolone resistance genes were present. Reports have shown that apart from the qnr genes, a variant of an aminoglycoside 6'-N-acetyltransferase, aac(60′)-Ib which confers resistance to tobramycin, amikacin and kanamycin can confer an incremental resistance to fluoroquinolones. [14] A mutant allele with the Trp102Arg and Asp179Tyr changes can acetylate ciprofloxacin resulting in resistance. To find out if the high level of fluoroquinolone resistance is due to the presence of this gene, we analysed the presence of aac(6′)-Ib by PCR.

Screening for the aac(6')-1b gene in Klebsiella pneumoniae isolates and identification of the cr mutant

Plasmids isolated from 16 isolates including one ciprofloxacin-sensitive isolate was analysed by aac (6') - 1b-specific PCR. Thirteen isolates showed the aac (6') - 1b gene and three isolates did not amplify the gene [Figure 6]. The E. coli JM109 transformants containing the plasmid pKNMGR12 or pKNMGR13 also showed the specific amplification. The amplified product of the aac (6') - 1b from the plasmid pKNMGR13 was sequenced using an internal primer [Figure 7]. This sequence contained the Trp102Arg and Asp179Tyr mutation confirming that this pNMGR13 contained the aac(6') 1b-cr mutant which can confer ciprofloxacin resistance. The presence of this gene along with the qnrA and qnrB in the plasmid pKNMGR13 could be responsible for conferring higher level of ciprofloxacin resistance. It remains to be seen whether the aac(6')-1b gene in other isolates carry the cr mutant of aac(6') 1b. This is the first study reporting the presence of the aminoglycoside acetyl transferase gene aac(6')-1b and the presence of the bifunctional ciprofloxacin-resistant variant in K. pneumoniae isolates from Chennai.
Figure 6: Amplifi cation of aac(6')-Ib: PCR amplifi cation of 482 bp aac(6')-Ib gene from plasmids isolated from the clinical isolates of Klebsiella pneumoniae is shown. WC - water control. The plasmid isolated from isolate P23 also did not amplify this gene (data not shown)

Click here to view
Figure 7: Partial sequence of aac(6') -1b-cr from pKNMGR13. The amino acid sequences from 92 to 189 are given. The amino acids which are variants in the bifunctional ciprofl oxacin-resistant mutant are circled

Click here to view



 ~ Discussion Top


This study screening for fluoroquinolone resistance in ESBL isolates of K. pneumoniae from Chennai collected in October 2009 showed that 61% isolates were resistant to ciprofloxacin and 52% to levofloxacin. In an earlier study from our laboratory analysing 188 isolates of K. pneumoniae, collected during November 2007 to October 2008, we had observed 52% isolates resistant to ciprofloxacin. A study on 48 ESBL K. pneumoniae isolates collected in January 1999 to December 2003 in a University hospital located in Rome, Italy, reported 48% isolates resistant to Ciprofloxacin. [16] Together, these data clearly show that fluoroquinolone resistance is increasing among K. pneumoniae isolates.

The frequency of qnr genes in this study was found to be 69.5% for qnrA and 47.8% for qnrB. An analysis of the K. pneumoniae isolates obtained in the United States from 1999 to 2004 detected 14% qnrA and 6% qnrB in ceftazidime-resistant. [17] More recently, a study in clinical isolates of Enterobacteriaceae collected between 2001 and 2006 at Korea, 56.9% carried the qnr genes. [18] This is the first report after the discovery of the qnrA and qnrB gene from South India where a screening for both qnrA and qnrB has been reported from India.

Although the resistant isolates did show the presence of the qnr alleles, among the four sensitive isolates, two harboured the qnrB allele and one harboured the qnr A allele. This could be due to the following reasons. The resistance to quinolones due to the presence of Qnr A is the result of Qnr binding to gyrase or topoisomerase IV at a site overlapping the DNA binding site for ciprofloxacin. The level of resistance conferred by the genes is believed to be a result of the copy number and the transcriptional level of the qnr genes. [19] Furthermore, the resistance can be cumulative due to the presence of other quinolone resistance genes.

The plasmid borne nature of the quinolone resistance was shown for the isolates P12 and P13. Plasmids from the isolates P12 and P13 gave a very high MIC of 240 μg/ml to ciprofloxacin when transformed into the E. coli strain JM109. Since qnr genes are reported to give only a low level of quinolone resistance, [20] it is highly likely that these plasmids contain additional genes conferring quinolone resistance. AAC(6′)-Ib-cr, a variant aminoglycoside acetyltransferase capable of modifying ciprofloxacin and reducing its activity, has been reported to be widely prevalent and circulated together with qnr genes. [21] The complete nucleotide sequence of plasmid pKP96, which carries the PMQR determinants qnrA1, aac(6′)-Ib-cr and the blaCTX-M-24 ESBL coding gene from K. pneumoniae isolated in China [22] has been reported. This plasmid was found to contain a complex class 1 integron consisting of aac(6′)-Ib-cr, qacEdelta1, sul1, ISCR1, qnrA1, ampR, orf5 and orf6.

Our analysis of the isolates revealed that 13 isolates out of 19 tested harboured the aac-(6')-1b gene encoding aminoglycoside 6'-N-acetyltransferase, which confers resistance to amikacin, kanamycin and tobramycin and found to be broadly distributed geographically and present in many clinically important Gram-negative rods. [3] A variant, aac(6')-Ib-cr, with the additional property of acetylating and inactivating fluoroquinolones with an accessible amino nitrogen on the piperazine ring, was described in 2006, encoded by a plasmid isolated in 2000-2001 from Shanghai. [6] The enzyme encoded by aac(6')-Ib-cr differs from aac(6')-Ib by only two amino acid substitutions, both of which are required for the enhanced substrate recognition. The "cr" variant was subsequently found to be widely distributed around the world. [3] Our results show the presence of the aac(6')-1b gene in the Klebsiella isolates from Chennai and the presence of the cr variant in at least one of the isolates.

This report is significant since this is the first report showing that PMQR is prevalent in K. pneumoniae in Chennai. Our earlier analysis on these isolates had shown the presence of the CTX-M gene and the IncF1C replicon in the plasmid pKNMGRP13. [23] Further complete sequencing of the resistance plasmid will be very important to identify the presence of genes such as qepA, an efflux protein conferring resistance to ciprofloxacin; the genetic context of the resistance genes which can give clues to the transfer mechanisms across species and the plasmid backbone carrying the resistance determinants.


 ~ Acknowledgement Top


This project was supported by a research grant from Council of Industrial and Scientific Research, India to Rama Vaidyanathan (No. 37(1385) 09/EMR-II (2009)). H. Magesh was supported by a Senior Research Fellowship from CSIR.

 
 ~ References Top

1.Lesher GY, Froelich EJ, Gruett MD, Bailey JH, Brundage RP. 1,8 Naphthyridine derivatives. A new class of chemotherapeutic agents. J Med Pharm Chem 1962;91:1063- 5.  Back to cited text no. 1
    
2.Hamad B. The antibiotics market. Nat Rev Drug Discov 2010;9:675-6.  Back to cited text no. 2
    
3.Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A. Plasmid-Mediated Quinolone Resistance: A Multifaceted Threat. Clin Microbiol Rev 2009;22:664-89.  Back to cited text no. 3
    
4.Hooper DC. Mechanisms of action and resistance of older and newer fluoroquinolones. Clin Infect Dis 2000;2:S24-8.  Back to cited text no. 4
    
5.Martínez-Martínez L, Pascual A, Jacoby GA. Quinolone resistance from a transferable plasmid. Lancet 1998;351:797- 9.  Back to cited text no. 5
    
6.Robicsek A, Strahilevitz J, Jacoby GA, Macielag M, Abbanat D, Park CH, et al. Fluoroquinolone-modifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase. Nat Med 2006;12:83-8.  Back to cited text no. 6
    
7.Park YJ, Yu JK, Kim SI, Lee K, Arakawa Y. Accumulation of plasmid-mediated fluoroquinolone resistance genes, qepA and qnrS1, in Enterobacter aerogenes co-producing RmtB and class A beta-lactamase LAP-1. Ann Clin Lab Sci 2009;39:55- 9.  Back to cited text no. 7
    
8.Jacoby GA, Walsh KE, Mills DM, Walker VJ, Oh H, Robicsek A, et al. qnrB, Another Plasmid-Mediated Gene for Quinolone Resistance. Antimicrob Agents Chemother 2006;50:1178-82.  Back to cited text no. 8
    
9.Wang M, Guo Q, Xu X, Wang X, Ye X, Wu S, et al. New Plasmid-Mediated Quinolone Resistance Gene, qnrC, Found in a Clinical Isolate of Proteus mirabilis. Antimicrob Agents Chemother 2009;53:1892-7.  Back to cited text no. 9
    
10.Hata M, Suzuki M, Matsumoto M, Takahashi M, Sato K, Ibe S, et al. Cloning of a Novel Gene for Quinolone Resistance from a Transferable Plasmid in Shigella flexneri 2b. Antimicrob Agents Chemother 2005;49:801-3.  Back to cited text no. 10
    
11.Cavaco LM, Hasman H, Xia S, Aarestrup FM. QnrD, a Novel Gene Conferring Transferable Quinolone Resistance in Salmonella enterica Serovar Kentucky and Bovismorbificans Strains of Human Origin. Antimicrob Agents Chemother 2009;53:603-8.  Back to cited text no. 11
    
12.CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twentieth Informational Supplement, M100-S20, Vol 30, No. 1, January 2010.  Back to cited text no. 12
    
13.Wu JJ, Ko WC, Tsai SH, Yan JJ. Prevalence of Plasmid-Mediated Quinolone Resistance Determinants QnrA, QnrB, and QnrS among Clinical Isolates of Enterobacter cloacae in a Taiwanese Hospital. Antimicrob Agents Chemother 2007;51:1223-7.  Back to cited text no. 13
    
14.Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac(6')-Ib-cr Encoding a Ciprofloxacin-Modifying Enzyme. Antimicrob Agents Chemother 2006;50:3953-5.  Back to cited text no. 14
    
15.Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother 2007;60:394-7.  Back to cited text no. 15
    
16.Tumbarello M, Spanu T, Sanguinetti M, Citton R, Montuori E, Leone F, et al. Bloodstream Infections Caused by Extended-Spectrum-{beta}-Lactamase-Producing Klebsiella pneumoniae: Risk Factors, Molecular Epidemiology, and Clinical Outcome. Antimicrob Agents Chemother 2006;50:498-504.  Back to cited text no. 16
    
17.Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr Prevalence in Ceftazidime-Resistant Enterobacteriaceae Isolates from the United States. Antimicrob Agents Chemother 2006;50:2872-4.  Back to cited text no. 17
    
18.Kang HY, Tamang MD, Seol SY, Kim J. Dissemination of Plasmid-mediated qnr, aac(6')-Ib-cr, and qepA Genes among 16S rRNA Methylase Producing Enterobacteriaceae in Korea. J Bacteriol Virol 2009;39:173-82.  Back to cited text no. 18
    
19.Rodríguez-Martínez JM, Velasco C, Pascual A, García I, Martínez-Martínez L. Correlation of quinolone resistance levels and differences in basal and quinolone-induced expression from three qnrA-containing plasmids. Clin Microbiol Infect 2006;12:440-5.  Back to cited text no. 19
    
20.Tran JH, Jacoby GA. Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci USA 2002;99:5638- 42.  Back to cited text no. 20
    
21.Jiang Y, Zhou Z, Qian Y, Wei Z, Yu Y, Hu S, et al. Plasmid-mediated quinolone resistance determinants qnr and aac(6')-Ib-cr in extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in China. J Antimicrob Chemother 2008;61:1003-6.  Back to cited text no. 21
    
22.Shen P, Jiang Y, Zhou Z, Zhang J, Yu Y, Li L. Complete nucleotide sequence of pKP96, a 67 850 bp multiresistance plasmid encoding qnrA1, aac(6′)-Ib-cr and bla CTX-M-24 from Klebsiella pneumoniae. J Antimicrob Chemother 2008;62:1252-6.  Back to cited text no. 22
    
23.Kamatchi C, Sumathi G, Vaidyanathan R. A pilot study on replicon typing of plasmids associated with SHV, OXA-1 and CTX-M genes in clinical isolates of Klebsiella pneumoniae from Chennai. Manuscript accepted for publication in Advanced Biotech. 2011.  Back to cited text no. 23
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]
 
 
    Tables

  [Table 1]

This article has been cited by
1 Trend of plasmid-mediated quinolone resistance genes at the Childrenęs Hospital in Tunisia
N. E.-H. Jlili,S. Rejiba,H. Smaoui,T. Guillard,F. Chau,A. Kechrid,E. Cambau
Journal of Medical Microbiology. 2014; 63(Pt_2): 195
[Pubmed] | [DOI]
2 Prevalence of Quinolone Resistance Among Extended-Spectrum ß -Lactamase Producing Uropathogenic Klebsiella pneumoniae
Fereshteh Raei,Fereshteh Eftekhar,Mohammad Mehdi Feizabadi
Jundishapur Journal of Microbiology. 2014; 7(6)
[Pubmed] | [DOI]
3 Antibiotic resistance: Some thoughts
Raghunath, D.
National Medical Journal of India. 2011; 24(5): 257-259
[Pubmed]



 

Top
Print this article  Email this article
 

    

© 2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04