Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 321 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (355 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~  Introduction
 ~  Materials and Me...
 ~  Results
 ~  Discussion
 ~  Acknowledgment
 ~  References
 ~  Article Tables

 Article Access Statistics
    Viewed8574    
    Printed374    
    Emailed10    
    PDF Downloaded809    
    Comments [Add]    
    Cited by others 7    

Recommend this journal

 


 
  Table of Contents  
ORIGINAL ARTICLE
Year : 2011  |  Volume : 29  |  Issue : 1  |  Page : 51-55
 

Evaluation of a commercial Dengue NS1 enzyme-linked immunosorbent assay for early diagnosis of dengue infection


1 Defence Research and Development Establishment, Jhansi Road, Gwalior-474 002, India
2 Army Hospital (Research & Referral) , New Delhi, India

Date of Submission27-Nov-2010
Date of Acceptance18-Jan-2011
Date of Web Publication7-Feb-2011

Correspondence Address:
A Shrivastava
Defence Research and Development Establishment, Jhansi Road, Gwalior-474 002
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.76525

Rights and Permissions

 ~ Abstract 

Purpose: Dengue is one of the most serious mosquito-borne viral infections affecting tropical and subtropical countries in the world. Since there is no immunoprophylactic or specific antiviral therapy available, timely and rapid diagnosis plays a vital role in patient management and implementation of control measures. This paper evaluates a commercially available NS1 antigen capture ELISA vis-a-vis SD bioline Dengue NS1 antigen test for early detection of dengue virus. Materials and Methods: To evaluate a commercial NS1 antigen detection kit vis-a-vis SD bioline Dengue NS1 antigen test, a total of 91 clinical samples were tested. Virological investigations with regard to dengue virus, viz. NS1 antigen capture ELISA (Panbio, Australia), SD bioline Dengue NS1 antigen test, RT-PCR and virus isolation were performed. Results: Out of 91 samples, 24 (26%) were positive by NS1 antigen capture ELISA, 15 (16%) by SD bioline Dengue NS1 antigen test and 11(12%) positive by RT-PCR analysis. The RT-PCR-positive samples were further subjected to virus isolation and resulted in three isolates. The results of the Panbio NS1 antigen capture ELISA, SD bioline Dengue NS1 antigen test, RT-PCR and virus isolation were correlated among themselves. Conclusions: The present study comprehensively established the utility of NS1 antigen ELISA in early diagnosis of dengue infection.


Keywords: Antigen capture, dengue virus, ELISA, lateral flowthrough test, non-structural 1 protein


How to cite this article:
Shrivastava A, Dash P K, Tripathi N K, Sahni A K, Gopalan N, Lakshmana Rao P V. Evaluation of a commercial Dengue NS1 enzyme-linked immunosorbent assay for early diagnosis of dengue infection. Indian J Med Microbiol 2011;29:51-5

How to cite this URL:
Shrivastava A, Dash P K, Tripathi N K, Sahni A K, Gopalan N, Lakshmana Rao P V. Evaluation of a commercial Dengue NS1 enzyme-linked immunosorbent assay for early diagnosis of dengue infection. Indian J Med Microbiol [serial online] 2011 [cited 2019 Sep 18];29:51-5. Available from: http://www.ijmm.org/text.asp?2011/29/1/51/76525



 ~ Introduction Top


Dengue fever is an important mosquito-borne viral disease of humans. This has been a recurrent phenomenon throughout the tropics in the past decade. Annually, there are an estimated 100 million dengue virus infections worldwide.[1] Increasingly, cases of the more severe and potentially lethal dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are reported with children bearing much of the disease burden. [2] The mortality rate of DHF in most countries is 5%, primarily among children and young adults. [3] In several Asian countries, this virus is the leading cause of hospitalization and death in children.[3] Hence, there is a need for diagnostics, prophylactics and therapeutics to manage DHF. Dengue virus is an enveloped positive-sense RNA virus. The genomic RNA is approximately 11 kb in length and is composed of three structural protein genes that encode for nucleocapsid or core protein(C), a membrane-associated protein (M), an envelope protein (E), and seven non-structural (NS) protein genes including NS1 protein. [4] Among the non-structural proteins, NS1 is a highly conserved glycoprotein which appears essential for virus replication, although no precise function has yet been assigned to it. During acute dengue virus infection, NS1 is found associated with intracellular organelles or is transported through the cellular secretory pathway to the cell surface. [5],[6],[7] The hexameric form of dengue virus NS1 protein was also found circulating in the sera of patients during the acute phase of the illness. [8] Early diagnosis plays a crucial role in forecasting an early warning of an epidemic and in undertaking effective vector control measures. The precise diagnosis is achieved either by isolating the virus or by identifying viral RNA through RT-PCR [6] or by serodiagnosis by detecting dengue-specific IgM and IgG antibodies. [9] Both virus isolation and RT-PCR are time-consuming and costly laboratory methods. Thus, in a majority of cases the only feasible diagnosis is based on the detection of dengue antigens or antibodies. An enzyme-linked immunosorbent assay specific to dengue virus non-structural 1 (NS1) protein has been developed for the detection of dengue NS1 antigen during the acute phase of disease in patients experiencing primary and secondary infections. [8],[9],[10],[11] It possesses not only group-specific but also type-specific determinants and has been recognized as an important antigen in dengue infection. [7],[9] A high circulating level of NS1 was demonstrated in the acute phase of dengue by antigen capture ELISAs. [10],[11] Antigen detection of non-structural dengue antigens may be of benefit for an early-stage rapid diagnosis of infection due to its long half life in the blood. [12] In this report, an evaluation of a commercially available dengue NS1 antigen-capture ELISA vis-à-vis SD bioline Dengue NS1 antigen test was carried out to demonstrate its potential application for early laboratory confirmation of dengue infection compared with other laboratory methods of dengue diagnosis, viz. virus isolation and molecular detection of dengue genomic RNA by reverse transcriptase-polymerase chain reaction (RT-PCR).


 ~ Materials and Methods Top


The study

Blood specimens were collected from patients clinically suspected of dengue during September to November 2008 from the Army Hospital (Research & Referral), New Delhi and stored at this Virology laboratory, which is one of the National Apex Referral Labs designated by the Ministry of Health and Family Welfare, Government of India for laboratory confirmation of acute dengue. Most of the patients belonged to the age group of 15-30 years and male to female ratio was 1.7. In the laboratory, dengue virus isolation was carried out employing C6/36 cell-line obtained from the National Centre for Cell Sciences, Pune. Simultaneously, molecular detection for dengue virus genome by RT-PCR using our published oligonucleotide primers was carried out on the acute phase serum samples. Remaining excess serum samples were stored in a minus 80ºC freezer for later use.

Panbio rapid IC test for detection of IgM and IgG antibodies

All the samples were tested for detection of anti-dengue IgM and IgG antibodies employing Panbio rapid IC test as per manufacturer's protocol.

Panbio dengue early ELISA

One hundred microlitres of diluted (1:10 in serum diluent) patient serum, positive control, negative control, or calibrator was added to microwells precoated with a polyclonal capture anti-NS1 antibody and then incubated for 1 h at 37ºC. The plates were washed six times and incubated for an additional 1 h at 37ºC following the addition of HRP-conjugated anti-NS1 MAb. After an additional six washes, antibody complexes were detected by adding TMB and incubating samples for 10 min at room temperature. The reaction was stopped by adding stop solution (1 M H 3 PO 4 ), and the plates were read. The cut-off value was determined by multiplying the average OD of the calibrator (tested in triplicate) by the lot-specific calibration factor (provided in the kit insert). An index value was calculated by dividing the average OD of each sample by the cut-off value. Index values of <0.9, 0.9 to 1.1, and >1.1 were considered negative, equivocal, and positive, respectively.

SD Bioline dengue NS1 Antigen test

The Dengue NS1 antigen rapid test is an in-vitro immunochromatographic, one-step assay designed for the qualitative determination of dengue virus NS1 antigen in human serum, plasma for the diagnosis of early acute dengue infection. About one hundred microlitres of patient serum was added into the sample well marked "S" and the test result was interpreted in 15~20 min. The presence of only one colour line within the result window indicated negative result and the presence of two colour lines ("T" band and "C" line) indicated a positive result. When no control line (C) was found the test was concluded as invalid.

RNA isolation

Viral RNA was isolated from 140 μl of dengue-suspected serum samples employing QIAamp Viral RNA mini kit (QIAGEN, Germany) following manufacturer's protocol. Finally, RNA was eluted in 50 μl of DEPC-treated water and used as template for RT-PCR.

Reverse transcription-Polymerase chain reaction (RT-PCR)

RT-PCR was carried out using a set of primers for dengue virus complex consensus primers (D1: 5' TCAATATGCTAAAACGCGCGAGAAACCG 3' and D2: 5' TTGCACCAACAGTCAATGTCTTCAGGTTC 3'). Complementary DNA (cDNA) was synthesized in 20 μl reaction volume with RT mix comprising 5X-RT buffer, dNTPs, RNasin® ribonuclease inhibitor and Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, USA) for 1 h at 37ºC with dengue virus group-specific consensus downstream primer (D2) (GENSET, Singapore). The amplification of cDNA was carried out in 50 μl reaction volume with PCR mix containing 10X PCR buffer, 25 mM MgCl 2, dNTPs, Taq-DNA polymerase (Promega, USA),using dengue consensus upstream primer (D1), (GENSET, Singapore) in a thermal cycler (Perkin - Elmer-480). The thermal profile of the PCR reaction was: initial denaturation at 95ºC for 2 min followed by 30 cycles of denaturation at 94ºC for 30 sec, annealing at 54ºC for 2 min, extension at 72ºC for 2 min and final extension at 72ºC for 10 min. The PCR products were electrophoresed on 1.2% agarose gel.

Virus isolation

Dengue virus isolations were attempted in RT-PCR positive samples by tissue culture using 0.2 ml of patients' serum inoculated into each of the 25 cm 2 tissue culture flasks (Nunc, Roskilde, Denmark) containing Aedes albopictus mosquito (C6/36) cell monolayers. After 90 min of adsorption of the inoculum onto the cells at 28ºC, cell cultures were incubated for seven days at 28ºC. Cells were harvested for identification of virus using dengue complex-specific primers in conventional reverse transcriptase polymerase chain reaction as described above.


 ~ Results Top


All 91 serum samples were tested by NS1 Capture ELISA (Panbio, Australia) as well as SD lateral flow NS1 test kits (Standard Diagnostics, South Korea) for the detection of NS1 antigen in dengue-infected serum samples. Detection of anti-dengue IgM and IgG antibodies was carried out by using Panbio rapid IC test. All the samples were also tested by RT-PCR, and those found positive were attempted for virus isolation. The results of Panbio dengue early ELISA were compared with those of SD lateral flow test. The overall performance of the Panbio Early ELISA NS1 antigen capture ELISA with respect to virus isolation, molecular detection and SD NS1 LFT in each category, is shown in [Table 1]. Out of 91 serum samples 24 (26%) were positive by the Panbio NS1 Early ELISA test kit and 15 (16.5%) by SD lateral flow test. From antibody profiles of all samples, six IgM, seven IgG and five both (IgM and IgG) positive samples were found. One IgM-positive sample was found positive for NS1 antigen by both NS1 antigen detection assays. None of the IgG-positive samples was found positive for NS1 antigen. However, one both (IgM and IgG) positive sample was NS1 antigen-positive by only Panbio dengue early ELISA. Molecular detection of dengue RNA by RT-PCR gave an overall positive detection rate of 12% (11/91). Further, virus isolation from RT-PCR-positive samples resulted in three isolates which was again confirmed by RT-PCR. In comparison, virus isolation gave an overall positive isolation rate of 27.27% (03/11) with the RT-PCR-positive samples. All the 15 samples positive by SD test were also positive by Panbio test. All the three isolates were positive by Panbio test but only two isolates were positive by SD Test. Out of 11 RT-PCR-positive samples, eight samples were positive by Panbio test and seven samples by SD test. All the seven samples positive by SD test were also positive by Panbio test. The distribution of OD 450 range with respect to all the samples is presented in [Table 2]. OD 450 values of ≥0.5 were considered positive at a serum dilution of 1:10. The results of dengue early ELISA versus SD NS1 LFT are given in [Table 3]. The sensitivity, specificity, agreement, positive predictive value and negative predictive value are presented in [Table 4].
Table 1 :Summary of dengue-positive samples by different assays

Click here to view
Table 2 :Range of OD450 values in panbio dengue early ELISA for human serum samples

Click here to view
Table 3 :Comparison of dengue early ELISA results vis-à-vis SD NS1 antigen test

Click here to view
Table 4 :Comparative evaluation of SD NS1 Ag LFT with reference to Panbio NS1 capture ELISA

Click here to view



 ~ Discussion Top


Dengue infection presents with nonspecific fever that mimics other viral illnesses. The availability of commercial ELISA assays to detect the DENV NS1 protein in acute plasma provides an additional dengue diagnostic tool to the existing approaches of PCR, antibody capture ELISA and, less frequently, virus isolation. [7],[8],[9],[13],[14],[15],[16],[17],[18] The assessment of NS1 antigen detection assays as diagnostic tools across a wide range of patient populations and viral serotypes is an important part of the process of identifying infections where these assays may fit into existing dengue diagnostic algorithms. In order to provide timely information for the management of the patients, and early public health control of dengue outbreaks, it is important to establish the diagnosis of acute dengue virus infection during the first few days after manifestation of clinical symptoms.

At present, the three basic methods used by most laboratories for the diagnosis of dengue virus infection are viral isolation; detection of viral genomic sequence by a nucleic acid amplification technology assay (RT-PCR), and detection of dengue virus-specific IgM antibodies by the IgM-capture enzyme-linked immunosorbent assay (MAC-ELISA) and/or the rapid dengue immunochromatographic test (ICT). Though virus isolation and characterisation are considered as the gold standard of laboratory diagnosis for acute dengue virus infection, it is expensive and takes at least 6-10 days for the virus to replicate in cell culture or laboratory mosquitoes. Detection of viral genomic sequence by RT-PCR is also an expensive method and is not widely available in most hospital diagnostic laboratories. The third method, assay of anti-dengue-specific IgM, depends on the time taken for an infected person's immunological response to produce IgM antibodies against dengue virus antigens. Thus, both ICT (often considered as the rapid test for diagnosis of dengue infection) and MAC-ELISA do not provide early diagnosis of acute dengue infection, as in most cases, the first detectable IgM only appears on days 4-5 of the illness. Moreover, a single serological detection of IgM is merely indicative of a recent dengue virus infection, and should not be interpreted as a confirmatory diagnosis of acute infection without a paired second serum sample. This evaluation clearly shows that the Panbio dengue early ELISA kit gives an overall higher sensitivity rate than SD bioline Dengue NS1 antigen test for laboratory diagnosis of acute dengue infection. The dengue early ELISA has the added advantage of giving good detection rates up to seven days of the illness. [8] The reason behind the less number of virus isolates could be the inactivation of the virus during transit due to improper maintenance of strict cold chain.

NS1 protein was found to be highly conserved for all dengue serotypes, circulating in high levels during the first few days of illness, and correlates with the development of DHF. [11],[16] Earlier studies found the presence of NS1 antigen in 82-83% of patients with dengue infection from day 1 up to day 9 to 18 after the onset of fever. [10],[19] The dengue NS1 antigen was not found in patients with Japanese encephalitis virus or yellow fever virus infections [18] thereby implying that there is no cross-reaction of dengue NS1 protein with those of other related flaviviruses. Thus detection of NS1 has been a promising test to diagnose dengue in its early febrile stage. [10],[19],[20],[21],[22],[23],[24]

Plasma viremia levels would be associated with the detection of plasma NS1, since NS1, like virions, is a product of infected cells. Accordingly, viremia levels were significantly higher in patients who were NS1-positive at the time of study enrolment versus those who were NS1-negative, in both the Panbio NS1 Early ELISA assay and SD NS1-LFT (data not shown). Firstly, not every acute dengue case has measurable NS1 antigenaemia and the present study suggests that this is a reflection of the viraemia, with NS1-negative patients having a significantly lower mean viraemia than NS1-positive patients with the same duration of illness history. Secondly, sensitivity declines with increasing time since the onset of symptoms and this is likely a reflection of decreasing viral burden. [9],[14],[17]

A possible explanation for reduced NS1 sensitivity in the presence of a measurable anti-DENV antibody response is that the plasma NS1 is sequestered in immune complexes and the target epitopes are not accessible to either the plate-bound or probe mAb in the NS1 ELISA. Indeed, efforts to dissociate immune complexes can enhance the sensitivity of the Panbio early ELISA assay. [13] They may already have an established anamnestic humoral immune response characteristic of a secondary infection and are therefore more likely to be NS1-negative. It is therefore imperative that clinicians and laboratorians should understand the limitations of existing NS1 antigen tests; that a NS1-negative result does not rule out the diagnosis of dengue. Further work is needed to determine the sensitivity of the test with a bigger sample size of patients. In conclusion, NS1 antigen test is a potentially useful test during early febrile stage. An outstanding point of the test is its high specificity during early infection. However, no single diagnostic assay in isolation is adequately sensitive and specific enough to diagnose all acute cases of dengue and therefore a battery of tests has to be performed to arrive at a confirmatory diagnosis of dengue infection.


 ~ Acknowledgment Top


The authors are thankful to Dr. R. Vijayaraghavan, Director, DRDE, Gwalior for his keen interest, support, providing necessary facilities for this study.

 
 ~ References Top

1.Gubler DJ, Meltzer M. Impact of dengue/dengue hemorrhagic fever on the developing world. Adv Virus Res 1999;53:35-70.  Back to cited text no. 1
[PUBMED]    
2.Whitehead SS, Blaney JE, Durbin AP, Murphy BR. Prospects for a dengue virus vaccine. Nat Rev Microbiol 2007;5:518-28.  Back to cited text no. 2
[PUBMED]  [FULLTEXT]  
3.World Health Organization. Key Issues in dengue vector control towards the operationalization of a global strategy: report of consultation. Geneva: WHO; 1995. (CTD/FIL (Den)/IC.96.1).  Back to cited text no. 3
    
4.Clyde K, Kyle JL, Harris E. Recent advances in deciphering viral and host determinants of dengue virus replication and pathogenesis. J Virol 2006:80:11418-31.  Back to cited text no. 4
    
5.Mackenzie JM, Jones MK, Young PR. Immunolocalization of the dengue virus nonstructural glycoprotein NS1 suggests a role in viral RNA replication. Virology 1996;220:232-40.  Back to cited text no. 5
[PUBMED]  [FULLTEXT]  
6.Guzman MG, Kouri G. Advances in dengue diagnosis. Clin Diagn Lab Immunol 1996;3:621-7.  Back to cited text no. 6
    
7.Blacksell SD, Mammen MP Jr, Thongpaseutha S, Gibbons RV, Jarman RG, Jenjaroen K, et al. Evaluation of the Panbio dengue virus nonstructural 1 antigen detection and IgM antibody enzyme-linked immunosorbent assays for the diagnosis of acute dengue infections in Laos. Diagn Microbiol Infect Dis 2008;60:43-9.  Back to cited text no. 7
    
8.Kumarasamy V, Chua SK, Hassan Z, Wahab AH, Chem YK, Mohamad M, et al, Evaluating the sensitivity of a commercial dengue NS1 antigen-capture ELISA for early diagnosis of acute dengue virus infection. Singapore Med J 2007;48:669-73.  Back to cited text no. 8
    
9.Kumarasamy V, Wahab AH, Chua SK, Hassan Z, Chem YK, Mohamad M, et al, Evaluation of a commercial dengue NS1 antigen-capture ELISA for laboratory diagnosis of acute dengue virus infection. J Virol Methods 2007;140:75-9.  Back to cited text no. 9
    
10.Alcon S, Talarmin A, Debruyne M, Falconar A, Deubel V, Flamand M. Enzyme-linked immunosorbent assay specific to dengue virus type 1 nonstructural protein NS1 reveals circulation of the antigen in the blood during the acute phase of disease in patients experiencing primary or secondary infections. J Clin Microbiol 2002;40:376-81.  Back to cited text no. 10
[PUBMED]  [FULLTEXT]  
11.Young PR, Hilditch PA, Bletchly C, Halloran W. An antigen capture enzyme-linked immunosorbent assay reveals high levels of the dengue virus protein NS1 in the sera of infected patients. J Clin Microbiol 2000;38:1053-7.  Back to cited text no. 11
[PUBMED]  [FULLTEXT]  
12.Das D, Mongkolaungkoon S, Suresh MR. Super induction of dengue virus NS1 protein in E. coli. Protein Expr Purif 2009;66:66-72.   Back to cited text no. 12
[PUBMED]  [FULLTEXT]  
13.Hang VT, Nguyet NM, Trung DT, Tricou V, Yoksan S, Dung NM, et al, Diagnostic accuracy of NS1 ELISA and lateral flow rapid tests for dengue sensitivity, specificity and relationship to viraemia and antibody responses. PLoS Negl Trop Dis 2009;3:e360.  Back to cited text no. 13
    
14.Dussart P, Petit L, Labeau B, Bremand L, Leduc A, Moua D et al, Evaluation of two new commercial tests for the diagnosis of acute dengue virus infection using NS1 antigen detection in human serum. PLoS Negl Trop Dis 2008;2:e280.  Back to cited text no. 14
    
15.Bessoff K, Delorey M, Sun W, Hunsperger E Comparison of two commercially available dengue NS1 capture enzyme-linked immunosorbant assays for diagnosis of acute DENV infection with a single clinical sample. Clin Vaccine Immunol 2008;15:1513-8.  Back to cited text no. 15
    
16.Dussart P, Labeau B, Lagathu G, Louis P, Nunes MR, Rodrigues SG, et al, Evaluation of an enzyme immunoassay for detection of dengue virus NS1 antigen in human serum. Clin Vaccine Immunol 2006;13:1185-9.  Back to cited text no. 16
    
17.Chuansumrit A, Chaiyaratana W, Pongthanapisith V, Tangnararatchakit K, Lertwongrath S, Yoksan S. The use of dengue nonstructural protein 1 antigen for the early diagnosis during the febrile stage in patients with dengue infection. Pediatr Infect Dis J 2008;27:43-8.  Back to cited text no. 17
[PUBMED]  [FULLTEXT]  
18.Lapphra K, Sangcharaswichai A, Chokephaibulkit K, Tiengrim S, Piriyakarnsakul W, Chakorn T, et al, Evaluation of an NS1 antigen detection for diagnosis of acute dengue infection in patients with acute febrile illness. Diagn Microbiol Infect Dis 2008;60:387-91.   Back to cited text no. 18
    
19.Xu H, Di B, Pan YX, Qiu LW, Wang YD, Hao W, et al Serotype 1-specific monoclonal antibody-based antigen capture immunoassay for detection of circulating nonstructural protein NS1 Implications for early diagnosis and serotyping of dengue virus infections. J Clin Microbiol 2006;44:2872-8.  Back to cited text no. 19
    
20.Huang JL, Huang JH, Shyu RH, Teng CW, Lin YL, Kuo MD, et al. High-level expression of recombinant dengue viral NS-1 protein and its potential use as a diagnostic antigen. J Med Virol 2001;65:553-60.  Back to cited text no. 20
[PUBMED]  [FULLTEXT]  
21.Shu PY, Chen LK, Chang SF, Yueh YY, Chow L, Chien LJ, et al. Dengue NS1-specific antibody responses: isotype distribution and serotyping in patients with dengue fever and dengue hemorrhagic fever. J Med Virol 2000;62:224-32.  Back to cited text no. 21
[PUBMED]  [FULLTEXT]  
22.Shu PY, Chen LK, Chang SF, Yueh YY, Chow L, Chien LJ. Comparison of capture immunoglobulin M (IgM) and IgG enzyme-linked immunosorbent assay (ELISA) and nonstructural protein NS1 serotype-specific IgG ELISA for differentiation of primary and secondary dengue virus infections. Clin Diagn Lab Immunol 2003;10:622-30.  Back to cited text no. 22
    
23.Shu PY, Chen LK, Chang SF, Su CL, Chien LJ, Chin C, et al. Dengue virus serotyping based on envelop and membrane and nonstructural protein NS1 serotype-specific capture immunoglobulin M enzyme-linked immunosorbent assay. J Clin Microbiol 2004;42:2489-94.  Back to cited text no. 23
[PUBMED]  [FULLTEXT]  
24.Valdes K, Alvarez M, Pupo M, Vazquez S, Rodriguez R, Guzman MG. Human dengue antibodies against structural and nonstructural proteins. Clin Diagn Lab Immunol 2000;7:856-7.  Back to cited text no. 24
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]

This article has been cited by
1 The 2011 outbreak of dengue virus infection in Malwa region of Punjab, India-an evaluation of various diagnostic tests
Neerja Jindal,Renu Bansal,Nitika Dhuria
Asian Pacific Journal of Tropical Disease. 2014; 4(5): 363
[Pubmed] | [DOI]
2 Lineage shift of dengue virus in Eastern India: an increased implication for DHF/DSS
A. SHRIVASTAVA,M. SONI,S. SHRIVASTAVA,S. SHARMA,P. K. DASH,N. GOPALAN,P. K. BEHERA,M. M. PARIDA
Epidemiology and Infection. 2014; : 1
[Pubmed] | [DOI]
3 Diagnostic utility of dengue NS1 antigen
Bhaskar Shenoy,Anupama Menon,Suvarna Biradar
Pediatric Infectious Disease. 2014;
[Pubmed] | [DOI]
4 A sensor tip based on carbon nanotube-ink printed electrode for the dengue virus NS1 protein
Ana Carolina M.S. Dias,Sérgio L.R. Gomes-Filho,Mízia M.S. Silva,Rosa F. Dutra
Biosensors and Bioelectronics. 2013; 44: 216
[Pubmed] | [DOI]
5 Sensitivity and specificity of in vitro diagnostic device used for influenza rapid test in Taiwan
Kun-Teng Wang,Chia-Pei Lin,Yi-Ya Fang,Ming-Hui Kao,Daniel Yang-Chih Shih,Chi-Fang Lo,Der-Yuan Wang
Journal of Food and Drug Analysis. 2013;
[Pubmed] | [DOI]
6 Overview of plant-derived vaccine antigens: Dengue virus
Malabadi, R.B., Ganguly, A., da Silva, J.A.T., Parashar, A., Suresh, M.R., Sunwoo, H.
Journal of Pharmacy and Pharmaceutical Sciences. 2011; 14(3): 400-413
[Pubmed]
7 Association of platelet count and serological markers of dengue infection-importance of NS1 antigen
Kulkarni, R.D., Patil, S.S., Ajantha, G.S., Upadhya, A.K., Kalabhavi, A.S., Shubhada, R.M., Shetty, P.C., Jain, P.A.
Indian Journal of Medical Microbiology. 2011; 29(4): 359-362
[Pubmed]



 

Top
Print this article  Email this article
 

    

© 2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04