Indian Journal of Medical Microbiology IAMM  | About us |  Subscription |  e-Alerts  | Feedback |  Login   
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 Home | Ahead of Print | Current Issue | Archives | Search | Instructions  
Users Online: 1169 Official Publication of Indian Association of Medical Microbiologists 
  Search
 
 ~ Next article
 ~ Previous article 
 ~ Table of Contents
  
 ~  Similar in PUBMED
 ~  Search Pubmed for
 ~  Search in Google Scholar for
 ~Related articles
 ~  Article in PDF (321 KB)
 ~  Citation Manager
 ~  Access Statistics
 ~  Reader Comments
 ~  Email Alert *
 ~  Add to My List *
* Registration required (free)  

 
 ~  Abstract
 ~  Introduction
 ~  Materials and Me...
 ~  Results
 ~  Discussion
 ~  References
 ~  Article Figures
 ~  Article Tables

 Article Access Statistics
    Viewed3256    
    Printed173    
    Emailed1    
    PDF Downloaded193    
    Comments [Add]    
    Cited by others 1    

Recommend this journal

 


 
ORIGINAL ARTICLE
Year : 2010  |  Volume : 28  |  Issue : 4  |  Page : 290-294
 

Study of HIV-1 subtypes in serodiscordant couples attending an integrated counselling and testing centre in Mumbai using heteroduplex mobility analysis and DNA sequencing


Department of Microbiology, Seth GSMC & KEM Hospital, Mumbai, India

Date of Submission22-Oct-2009
Date of Acceptance29-Apr-2010
Date of Web Publication20-Oct-2010

Correspondence Address:
P R Mehta
Department of Microbiology, Seth GSMC & KEM Hospital, Mumbai
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0255-0857.71807

Rights and Permissions

 ~ Abstract 

Aims: To determine the prevalent subtypes of HIV-1 in serodiscordant couples. Setting: Integrated Counselling and Testing Centre (ICTC), Department of Microbiology. Study Design: Prospective pilot study. Participants: Thirty HIV-1 serodiscordant couples. Inclusion Criteria: a) Documentation of HIV-1 infection in one partner and seronegative status in the other, current history of continued unprotected sexual activity within the partnership, demonstration that they have been in a partnership for at least 1 year and are not currently on highly active antiretroviral therapy HAART; b) willingness of both partners to provide written informed consent including consent to continued couple counselling for 3 months. Materials and Methods: HIV-1 subtyping was carried out by heteroduplex mobility analysis (HMA) by amplifying env region; and DNA sequencing by amplifying gag region. Results: HIV-1 env gene was amplified successfully in 10/30 samples; gag gene, in 25/30 samples; and both env and gag gene were amplified successfully in 5/30 samples. HIV-1 subtype C was detected from 21 samples; subtype B, from 7; and subtype A, from 2. Sample from 1 positive partner was detected as subtype C by env HMA and subtype B by gag sequencing. Conclusion: HIV-1 subtype C was found to be the predominant subtype of HIV-1 in serodiscordant couples attending our ICTC, followed by HIV-1 subtype B and HIV-1 subtype A, respectively. DNA sequencing was found to be the most reliable method for determining the subtypes of HIV-1.


Keywords: DNA sequencing, HIV-1 subtypes, heteroduplex mobility analysis, serodiscordant couples


How to cite this article:
Mehta P R, Nema S, Paranjpe S, Ingole N, Wanjare S, Nataraj G. Study of HIV-1 subtypes in serodiscordant couples attending an integrated counselling and testing centre in Mumbai using heteroduplex mobility analysis and DNA sequencing. Indian J Med Microbiol 2010;28:290-4

How to cite this URL:
Mehta P R, Nema S, Paranjpe S, Ingole N, Wanjare S, Nataraj G. Study of HIV-1 subtypes in serodiscordant couples attending an integrated counselling and testing centre in Mumbai using heteroduplex mobility analysis and DNA sequencing. Indian J Med Microbiol [serial online] 2010 [cited 2019 Jun 20];28:290-4. Available from: http://www.ijmm.org/text.asp?2010/28/4/290/71807



 ~ Introduction Top


HIV discordance is an increasingly encountered phenomenon. Seronegative partners are a particular high-risk group for HIV acquisition; a high proportion of new HIV infections in mature generalized epidemic are likely to occur within discordant couples. [1] What accounts for high rates of HIV-1 discordance and why some individuals remain uninfected despite repeated sexual exposure to HIV-1 is not known. It has been suggested that certain HIV-1 subtypes may be adapted to more efficient heterosexual transmission. [2] In India, although multiple studies have been conducted for detecting HIV subtypes in various high-risk groups, [3],[4] little information is available on HIV-1 subtypes in serodiscordant couples. Hence a study was planned to assess the prevalence of HIV-1 subtypes in serodiscordant couples attending our ICTC, which will help to assess the efficiency of transmission associated with HIV-1 subtypes if any.


 ~ Materials and Methods Top


A prospective pilot study was carried out in the Integrated Counselling and Testing Centre (ICTC) of our department from September 2007 to August 2008 after getting permission from the institutional ethics committee. Thirty serodiscordant couples among whom one partner was HIV-1 seropositive (for more than 2 years) and the other seronegative with current history of continued unprotected sexual activity within the partnership for at least 1 year and who were not on highly active antiretroviral therapy HAART were enrolled for the study. Written informed consent of both partners including consent to continued couple counselling for 3 months was obtained.

Five millilitres of whole blood was collected in an Ethylene Diamine Tetra Acetic acid (EDTA) vacutainer from HIV-1 positive partner only. DNA extraction was done as described by Debomoy K. Lahiri and John I. Nurnberger, Jr. [5] Reagents for DNA extraction were obtained from Himedia Laboratories, Mumbai, India. Five millilitres of whole blood was collected from the negative partner after 3 months of enrolment at the time of follow-up and tested for HIV-1 antibody to prove continued discordance.

The DNA extracts that were found satisfactory both qualitatively and quantitatively [5] were stored in eppendorf tubes at −20C till further analysis. The stored DNA was carried on dry ice in batches of ten to molecular diagnostic laboratory at National AIDS Research Institute, Pune, where the heteroduplex mobility analysis (HMA) and DNA sequencing were carried out. Extracted DNA from all 30 seropositive partners was amplified using env primers for HMA and gag primers for sequencing.

Heteroduplex mobility analysis HMA

All the primers and plasmids for HMA were supplied by NIH AIDS Research and Reference Reagent Programme, Bethesda, USA.

Nested polymerase chain reaction (PCR) for amplifying the env region of HIV-1 was carried out as described by Delwart et al.[6] Primers ED5 5'- ATGGGATCAAAGCCTAAAGCCATGTG- 3' (6556-6581) and ED12 5'- AGTGCTTCCTGCTGCTCCCA AGAACCCAAG-3' (7822-7792) were used to amplify a fragment of approximately 1.25 Kb spanning the V1-V5 coding region of env gene in the first round. Five microlitres of the DNA sample was used. DNA amplification was achieved by programming the thermocycler (Applied Biosystem, Foster City, CA, USA) at 94C for 2 minutes followed by 3 cycles at 94C for 1 minute, 55C for 1 minute and 72C for 1 minute. Subsequent 32 cycles were at 94C for 15 seconds, 55C for 45 seconds and 72C for 1 minute; and the final incubation was at 72C for 5 minutes. Five microlitres of the amplicon from the first round was used in the next round. Primers ES7 5' -TGTAAAACGACGGCCAG TCTGTTAAATGGCAGTCTAGC-3'(7001-7020) and ES8 5' - CAGGAA ACAGCTAGTACCCACTTCTCCAATTGT CCCTCA-3 '(7667-7647) were used to amplify a fragment of 0.7 Kb spanning the V3-V5 coding region of env gene in the second round. PCR conditions were 94C for 2 minutes followed by 3 cycles at 94C for 1 minute, 58C for 1 minute and 72C for 1 minute. Subsequent 32 cycles were at 94C for 15 seconds, 58C for 45 seconds and 72C for 1 minute; and the final incubation was at 72C for 5 minutes. The amplified PCR products were run on 1% agarose gel containing ethidium bromide at 65-85 V for 30 minutes to confirm the presence of 700 bp PCR product.

HMA was performed as described by Delwart et al.[6] using plasmid PCR product representing subtype A1, B1, C4 and E2. The sample/ reference heteroduplex, which migrated closest to the corresponding homoduplex, determined the subtype designation. Amplified product from the patient's sample served as a control for the homoduplex formation in the absence of any reference strain [Figure 1] and [Figure 2].
Figure 1 :Heteroduplex mobility analysis (HMA) gel. M - DNA Ladder. 1 - Sample 1 + Sample 1, 2 - Sample 1 + Reference plasmid A1, 3 - Sample 1 + Reference plasmid B1, 4 - Sample 1 + Reference plasmid C4, 5 - Sample 1 + Reference plasmid E2, 6 - Sample 2 + Sample 2, 7 - Sample 2 + Reference plasmid A1, 8 - Sample 2 + Reference plasmid B1, 9 - Sample 2 + Reference plasmid C4, 10 - Sample 2 + Reference plasmid E2, Interpretation: Sample 1 - HIV-1 subtype B, Sample 2 - HIV-1 subtype C

Click here to view
Figure 2 :Heteroduplex mobility analysis (HMA) gel. M - DNA Ladder, 1 - Sample 1 + Sample 1, 2 - Sample 1 + Reference plasmid C4, 3 - Sample 1 + Reference plasmid B1, 4 - Sample 1 + Reference plasmid A1, 5 - Sample 1 + Reference plasmid E2. Interpretation: HIV-1 subtype A

Click here to view


DNA sequencing

gag
primers were supplied by Invitrogen Life Science, Carlsbad, California, USA.

For DNA sequencing, the gag region of HIV-1 was amplified using nested polymerase chain reaction (PCR). The 600-bp segment of p17 region of gag gene was amplified. Primers for the first round of PCR were GF1 5' TCTCTCGACGCAGGACTCGGCTTGCTG 3' and GC1 5' TAACATTTGCATGGCTGCTTGATGTCC 3'. DNA amplification was achieved by programming the thermocycler (Applied Biosystem, Foster City, CA, USA) at 94C for 2 minutes followed by 3 cycles at 94C for 1 minute, 65C for 1 minute and 72C for 1 minute. Subsequent 32 cycles were at 94C for 15 seconds, 65C for 45 seconds and 72C for 1 minute; and the final incubation was at 72C for 5 minutes. Five microlitres of the first round of PCR product was used as template for second round of PCR. Primers for the second round of PCR were GF2 5' CTAGAAGGAGAGAGAGATGGGTGCGAG 3' and GC2 5' CTTGTGGGGTGGCTCCTTCTGATAATG 3'. PCR conditions were 94C for 2 minutes followed by 3 cycles at 94C for 1 minute, 68C for 1 minute and 72C for 1 minute. Subsequent 32 cycles were at 94C for 15 seconds, 68C for 45 seconds and 72C for 1 minute; and the final incubation was at 72C for 5 minutes. PCR products were purified by using the method described by Joseph Sambrook et al. for purification of plasmid DNA. [7] Purified PCR products were amplified in the thermocycler (Applied Biosystem, Foster City, CA, USA) in a 96-well microtitre plate. The thermal cycling conditions were 25 cycles at 96C for 10 seconds, 50C for 5 seconds and 60C for 4 minutes. Purification of these new PCR products was achieved by using 80% isopropanol. Later on, 10 microlitres of formamide was added to each well of the plate and was centrifuged and heated at 94C for 2 minutes, followed by snap chilling on ice. Finally the products were subjected to direct sequencing with BigDye Terminator chemistry on an automated ABI PRISM; 3100 Genetic Analyzer (Applied Biosystem, Foster City, CA, USA). Sequences derived from subgenomic fragments of the gag region were edited by using Bioedit 5.0.6 software. Multiple sequence alignment was done using clustal X version 1.81, and contig was obtained. The subtype was defined by submitting contig to the HIV sequence database ( http://www.hiv.lanl.gov/content/sequence/BASIC_BLAST/basic_blast.html ).


 ~ Results Top


Of the 30 seropositive partners, 27 (90%) were males. Twenty-eight seropositive partners had unprotected sexual contact with multiple partners, and 2 had received blood transfusion.

HIV-1 env gene could be amplified in only 10 samples; and HIV-1 gag gene, in only 25 samples. env, gag or both genes could be amplified in all samples [Table 1].
Table 1 :Distribution of HIV-1 subtypes according to the methods used


Click here to view


HIV-1 subtype C was the predominant subtype, followed by subtype B and subtype A.

Subtype of 1 sample was detected as HIV-1 subtype C by env HMA and HIV-1 subtype B by gag sequencing.

After the 3-month follow-up, seroconversion was not detected in any of the seronegative partners.


 ~ Discussion Top


With increasing coverage of the National AIDS Control Programme in India, improved accessibility and sustained efforts to promote partner counselling and testing, the number of partners availing of these facilities is on the rise. With reports of low HIV-1 incidence in married serodiscordant couples, it has become apparent that a large number of couples affected by HIV-1 would be HIV-1-serodiscordant. [8] As seronegative partners within discordant relationship are a particular high-risk group for HIV acquisition, this situation has wide research and clinical implications. [1]

In the present study on serodiscordant couples, subtype C was the most predominant, followed by subtype B. In a very short time, India has experienced a rapid, explosive HIV epidemic. Multiple studies of HIV-1 subtypes confirm that subtype C is the most common subtype in India. [3],[4],[9],[10] A similar finding of concordance of subtype prevalence in serodiscordant couples and overall infected population has also been reported by Kiwanuka et al. from Uganda, where HIV-1 subtypes A and D are more common. [11] Sahni et al. found the presence of multiple subtypes, i.e., HIV-1 subtypes A, B, C and E, in India. [10] Although the above studies focused on detection of subtypes in various high-risk groups, to the best of our knowledge the present study on HIV-1 subtypes in HIV-serodiscordant couples is probably the first from India.

Various laboratory studies have demonstrated that different HIV subtypes have varying properties related to viral pathogenicity (such as viral fitness and CCR5 vs. CXCR4 tropism), and that these differences may influence transmission efficiency, disease progression and response to antiretroviral therapy. [12] Max Essex reported that HIV-1 subtype C and CRF01_AE (formerly called subtype E) replicate more efficiently than subtype B in Langerhans' cells. [13] These are the antigen-presenting cells abundantly found in the epithelium of the vagina, cervix and penile foreskin, which are absent in rectal mucosa and are responsible for vaginal transmission, and hence HIV-1 subtype C and CRF01_AE are believed to be transmitted more efficiently by heterosexual route than any other subtypes.

Of the 30 seropositive partners studied, 28 had acquired HIV infection through heterosexual route. HIV-1 subtype C was seen in 22 of these. As subtype B could be detected in 6 cases, it is possible that in India this subtype may have a greater role to play in heterosexual transmission as compared to countries in the regions like northern Africa and Middle East. [14]

Both serotyping and genotyping can be used for ascertaining HIV-1 subtypes. But in a country like India, where multiple subtypes predominate, subtype-specific serological techniques have limited role due to chances of cross-reactivity. Therefore, genotypic methods are preferred. In the present study, HIV-1 subtypes were detected by the two commonly recommended genotyping methods, viz., HMA and DNA sequencing.

In HMA, subtypes were ascertained by amplifying env region. Despite repeated attempts, env region could be amplified only in 10 out of 30 samples. A similar problem of amplification with env primers has also been reported by Mc Cutchan et al.[15] It is believed that broad heterogeneity within the gp120 region of the HIV-1 env region may be the reason for amplification failure. [15]

DNA sequencing using gag region primers was attempted as gag region is said to be more conserved than env region. [16] The gag region could be amplified in 25 of the 30 samples. Therefore, DNA sequencing was done on a total of 25/30 samples.

HMA was found to be labour intensive and time consuming as compared to DNA sequencing. Also, the env region could not be amplified in two thirds of the samples. Hence DNA sequencing using gag region primers was found to be better for subtype determination. Similar finding has also been reported by Mandal et al.[9]

Discordance in typing was observed with 1 sample, which was detected as subtype C by env HMA and subtype B by gag sequencing. A similar finding has been reported by Payel Bhanja et al. in injecting-drug users in Manipur. [17] This is because some viruses cluster in one subtype when gag sequences are analyzed and in another when env sequences are examined, which suggests that recombination can occur between viral genomes and result in replication-competent viruses. [18] Since the amplicon size was very small, we are unable to comment on the presence of any recombinant forms. Full-length genomic sequencing of such samples should be carried out for final identification of the subtype.

Various factors that can affect sexual transmission of HIV are HIV-1 viral load, presence of other sexually transmitted infections, CD4 count, sexual behaviour, Human Leukocyte Antigen (HLA) haplotypes and HIV subtypes. [11],[19]

It is possible that these additional parameters may determine the efficiency of heterosexual transmission, though it has been suggested that HIV-1 subtypes should be considered as a new parameter when constructing mathematical models of transmission.

To conclude, HIV-1 subtype C was found to be the commonest subtype in our study group. env region of the HIV-1 was difficult to amplify as compared to the gag region. DNA sequence analysis was found to be better than HMA for determining the nature of the HIV-1 subtype.

 
 ~ References Top

1.Robinson NJ, Mulder D, Auvert B, Whitworth J, Hayes R. Type of partnership and heterosexual spread of HIV infection in rural Uganda: Results from simulation modelling. Int J STD AIDS 1999;10:718-25.  Back to cited text no. 1  [PUBMED]  [FULLTEXT]  
2.Soto-Ramirez LE, Renjifo B, McLane MF, Marlink R, O′Hara C, Sutthent R, et al. HIV-1 Langerhans′ cell tropism associated with heterosexual transmission of HIV. Science 1996;271:1291-3.  Back to cited text no. 2  [PUBMED]  [FULLTEXT]  
3.Gadkari DA, Moore D, Sheppard HW, Kulkarni SS, Mehendale SM, Bollinger RC . Transmission of genetically diverse strains of HIV-1 in Pune, India. Indian J Med Res 1998;107:1- 9.   Back to cited text no. 3      
4.Mandal D, Jana S, Bhattacharya SK, Chakrabarti S. HIV type 1 subtypes circulating in eastern and northeastern regions of India. AIDS Res Hum Retroviruses 2002;18:1219-27.  Back to cited text no. 4  [PUBMED]  [FULLTEXT]  
5.Lahiri DK, Nurnberger JI Jr. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res 1991;19:5444.  Back to cited text no. 5  [PUBMED]  [FULLTEXT]  
6.Delwart EL, Shapaer EG, Louwagie J, McCutchan FE, Grez M, Rubsamen-Waigmann H, et al. Genetic relationships determined by a DNA heteroduplex mobility assay: Analysis of HIV-1 env genes. Science 1993;262:1257-61.  Back to cited text no. 6      
7.Sambrook J, Russel DW. Preparation of plasmid DNA by small-scale boiling lysis. Vol 1, 3 ed. Molecular cloning, a laboratory manual. New York, USA: Cold Spring Harbour Laboratory Press; 2001. p. 1.45.  Back to cited text no. 7      
8.Mehendale SM, Ghate MV, Kishore Kumar B, Sahay S, Gamble TR, Godbole SV, et al. Low HIV-1 incidence among married serodiscordant couples in Pune, India. J Acquir Immune Defic Syndr 2006;41:371-3.  Back to cited text no. 8  [PUBMED]  [FULLTEXT]  
9.Mandal D, Jana S, Panda S, Bhattacharya S, Ghosh TC, Bhattacharya SK, et al. Distribution of HIV-1 subtypes in female sex workers of Calcutta, India. Indian J Med Res 2000;112:165-72.  Back to cited text no. 9  [PUBMED]    
10.Sahni AK, Prasad VV, Seth P. Genomic diversity of human immunodeficiency virus type-1 in India. Int J STD AIDS 2002;13:115-8.  Back to cited text no. 10  [PUBMED]  [FULLTEXT]  
11.Kiwanuka N, Gray R, Ssekasanvu J, Bwanika JB, Makumbi F, Nalugoda F, et al. HIV-1 subtype and heterosexual transmission of HIV among HIV-1 discordant couples in Rakai, Uganda. Abstract MOAX0304, 2008. XVII International AIDS Conference, 3-8 August 2008, Mexico City. Available from: http://www.aids2008.org/Pag/Abstracts.aspx?SID=323andAID=14460. [Accessed on 2008 November 5].  Back to cited text no. 11      
12.Graham SM. Clinical impact of HIV-1 subtype: Are there important differences? Future HIV Therapy 2007;1:273-90.  Back to cited text no. 12      
13.Essex M. Retroviral vaccines: Challenges for the developing world. AIDS Res Hum Retroviruses 1996;12:361-3.  Back to cited text no. 13  [PUBMED]    
14.Osmanov S, Pattou C, Walker N, Schwardlδnder B, Esparza J; WHO-UNAIDS Network for HIV Isolation and Characterization. Estimated global distribution and regional spread of HIV-1 genetic subtypes in the year 2000. J Acquir Immune Defic Syndr 2002;29:184-90.   Back to cited text no. 14      
15.McCutchan FE, Ungar BL, Hegerich P, Roberts CR, Fowler AK, Hira SK, et al. Genetic analysis of HIV-1 isolates from Zambia and an expanded phylogenetic tree for HIV-1. J Acquir Immune Defic Syndr 1992;5:441-9.  Back to cited text no. 15  [PUBMED]    
16.Goulder PJ, Watkins DI. Impact of MHC class I diversity on immune control of immunodeficiency virus replication. Nat Rev Immunol 2008;8:619-30.   Back to cited text no. 16  [PUBMED]  [FULLTEXT]  
17.Bhanja P, Sengupta S, Singh NY, Sarkar K, Bhattacharya SK, Chakrabarti S. Determination of gag and env subtypes of HIV-1 detected among injecting drug users (IDUs) in Manipur, India: Evidence for intersubtype recombination. Virus Res 2005;114:149-53.  Back to cited text no. 17  [PUBMED]  [FULLTEXT]  
18.Iversen AK, Learn GH, Fugger L, Gerstoft J, Mullins JI, Skinhoj P. Presence of multiple HIV subtypes and a high frequency of subtype chimeric viruses in heterosexually infected women. J Acquir Immune Defic Syndr 1999;22:325-32.  Back to cited text no. 18  [PUBMED]  [FULLTEXT]  
19.Guthrie BL, de Bruyn G, Farquhar C. HIV-1-discordant couples in sub-Saharan Africa: Explanations and implications for high rates of discordancy. Curr HIV Res 2007;5:416-29.  Back to cited text no. 19  [PUBMED]  [FULLTEXT]  


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]

This article has been cited by
1 HIV Diversity and Classification, Role in Transmission
Duri Kerina,Stray-Pedersen Babill,F. Muller
Advances in Infectious Diseases. 2013; 03(02): 146
[Pubmed] | [DOI]



 

Top
Print this article  Email this article
Previous article Next article

    

2004 - Indian Journal of Medical Microbiology
Published by Wolters Kluwer - Medknow

Online since April 2001, new site since 1st August '04