|
| BRIEF COMMUNICATION |
|
|
|
| Year : 2007 | Volume
: 25
| Issue : 3 | Page : 249-252 |
| |
Determination of hepatitis C virus genotypes by melting-curve analysis of quantitative polymerase chain reaction products
MS Alfaresi, AA Elkoush
Department of Pathology and Laboratory Medicine - Microbiology Division, Zayed Military Hospital, Abu Dhabi, United Arab Emirates
| Date of Submission | 09-Feb-2006 |
| Date of Acceptance | 25-Mar-2007 |
Correspondence Address: M S Alfaresi Department of Pathology and Laboratory Medicine - Microbiology Division, Zayed Military Hospital, Abu Dhabi United Arab Emirates
  | 2 |
DOI: 10.4103/0255-0857.34768 PMID: 17901644
Hepatitis C virus (HCV) is the major causative agent of non-A and non-B viral hepatitis. Factors associated with disease progression following HCV infection include the viral genotype, the patient's alcohol consumption, and viral load. In this study, the COBAS AMPLICOR HCV MONITOR test, a commercially available quantitative assay for HCV RNA, was used for HCV genotyping analysis. Amplification products obtained from 100 HCV-positive cases were subjected to real-time polymerase chain reaction (PCR) typing using a single pair of fluorescence resonance energy transfer (FRET) probes and melting-curve analysis. Of 100 samples tested, two inhibited the PCR, two samples yielded discrepancies between our results and the reference laboratory results, and the remaining samples provided correct typing. The present report suggests that HCV genotypes can be determined rapidly with FRET probes directly from COBAS AMPLICOR MONITOR test PCR products.
Keywords: Hepatitis C virus genotyping, real-time polymerase chain reaction
How to cite this article: Alfaresi M S, Elkoush A A. Determination of hepatitis C virus genotypes by melting-curve analysis of quantitative polymerase chain reaction products. Indian J Med Microbiol 2007;25:249-52 |
How to cite this URL: Alfaresi M S, Elkoush A A. Determination of hepatitis C virus genotypes by melting-curve analysis of quantitative polymerase chain reaction products. Indian J Med Microbiol [serial online] 2007 [cited 2013 May 20];25:249-52. Available from: http://www.ijmm.org/text.asp?2007/25/3/249/34768 |
Hepatitis C virus (HCV) is the major causative agent of non-A, non-B viral hepatitis. [1],[2] Acute HCV infection is often asymptomatic, and approximately 70% of cases progress to chronic hepatitis. This may lead to progressive liver disease, cirrhosis, liver failure, and hepatocellular carcinoma within 20 to 30 years. Factors associated with disease progression following HCV infection include viral genotype, the patient's alcohol consumption, and viral load. [3]
Much effort has been directed toward establishing therapeutic strategies against the HCV genome. [4],[5],[6],[7] For this reason, in addition to quantitative polymerase chain reaction (PCR), genotyping has become increasingly important in routine laboratory diagnostics. The most effective way to obtain data on these two parameters would be to use the same amplicons for diagnostic HCV RNA detection and for genotyping. [8]
The determination of the HCV genotype provides clinically important information that can be used to direct the type and duration of antiviral therapy and to predict the likelihood of sustained HCV clearance after therapy. [9],[10],[11],[12] Because patients with HCV genotype 1 may benefit from a longer course of therapy and genotypes 2 and 3 are more likely to respond to combination interferon-ribavirin therapy, the common, clinically relevant distinction in the US population is between genotype 1 and genotypes 2 and 3. [13],[14] Insufficient data currently exist regarding the therapeutic response of HCV genotypes 4, 5, 6, and 7.
A large number of methods have been developed for HCV genotyping. However, these methods are laborious and expensive. In this study, the COBAS AMPLICOR HCV MONITOR test, a commercially available quantitative assay for HCV RNA, was used. Amplification products obtained from HCV positive cases were subjected to real-time PCR typing using a single pair of FRET probes and melting-curve analysis. The primary goal in the design of this assay was to identify type 1 HCV.
| ~ Materials and Methods | |  |
Clinical samples
Serum samples from 98 seropositive hepatitis C patients were analyzed for HCV RNA levels between January 2003 and December 2004. Serum was separated from whole blood collected in serum separation tubes and immediately stored at -80°C.
Quantification of HCV RNA in serum
A commercial assay for the quantification of serum HCV, COBAS HCM-2, was used. This assay was carried out strictly in accordance with the manufacturer's instructions. COBAS HCM-2 is based on reverse transcription (RT) and HCV RNA amplification with the oligonucleotide primers KY80 (5′GCAGAAAGCGTCTAGCCATGGCGT) and KY78 (5′CTCGCAAGCACCCTATCAGGCAGT), which target the 244 bp region located within the highly conserved 5′ noncoding region of the HCM genome. An internal quantitation standard (HCM QS) was diluted in lysis buffer, added to each sample, and was co amplified with the HCM RNA target. HCM QS is a noninfectious RNA transcript that has primer-binding regions identical to those of the HCV target RNA but a probe-binding region different from that of the target amplicon. Both the amplified products of the internal standard and sample RNA were serially diluted and detected by probe hybridization. Final PCR products were purified using the Roche purification kit to eliminate excess deoxyribonucleotides and amplification primers and were then frozen in aliquots for further real-time genotyping.
Primers and probes
Primers and probes for seminested PCR and HCV genotype determination in the LightCycler consisted of the forward primer HCV SF2 (5′GTGCAGCCTCCAGGACCCCC), the reverse primer NAR3 (5′CCCTATCAGGCAGTACCACAA), the FRET anchor probe HCVG-flourescein isothiocyanate (5′-GCCATAGTGGTCTGCGGAACCGGT); 5′-LCRed640-GTACACCGGAATTGCCAGGA-phosphate-3′). Both primers and the FRET probes have been published previously [15],[16] and were purchased from TIB MOLBIOL, Germany.
Real-time genotyping
Seminested, "hot start" PCR reactions were performed in a final volume of 10 µL, using the LightCycler-FastStart DNA master hybridization probes reaction kit. We combined 2.5 µL of the COBAS AMPLICOR reaction product (after purification) with 7.5 µL master mix in 20 µL LightCycler glass capillaries and seminested PCR was performed in the Roche LightCycler. Each 7.5 µL reaction contained 1 mM MgCl 2 , 0.25 µM forward primer HCV SF2, 0.25 µM reverse primer NAR3, 0.2 µM HCVG-FITC probe, 0.2 µM RED-HCVG probe, and 1x LightCycler FastStart DNA master hybridization probes mix (contributing an additional 1 µM so that the final MgCl 2 concentration was 2 µM per reaction). After a preincubation step at 95°C for 10 minutes to activate the FastStart polymerase, PCR amplification (50 cycles) consisted of denaturation at 95°C for 3 seconds and a temperature transition rate of 20°C s, -1 annealing at 56 °C for 10 seconds with a temperature transition rate of 20°C s, -1 , a single fluorescence measurement taken at the end of the annealing step and extension at 72°C for 12 seconds with a temperature transition rate of 0.5°C s. -1 After amplification, melting curve analysis was performed by heating to 95°C for 5 seconds with a temperature transition rate of 20°C s -1 , cooling to 40°C with a temperature transition rate of 20°C s -1 , holding at 40°C for 30 seconds and then heating the sample to 80°C at 0.1°C s. -1 Fluorescence data were collected continuously during this heating step to monitor the dissociation of the RED-HCVG sensor probe. The derivative melting curves were obtained using the LightCycler 4.0 data analysis software (Roche).
Comparative testing
To compare this novel method with a standard genotyping method, the same 98 serum samples were genotyped by hybridization with sequence-specific oligonucleotides. [17]
| ~ Results | |  |
For optimal discrimination, the FITC-labeled anchor probe was designed to anneal to an invariant region of the 5′-UTR. The fluorescence resonance energy transfer (FRET) sensor probe was designed to allow discrimination of HCV genotypes 1a/b, 2a/c, 2b, 3a, and 4 during melting curve analysis because it hybridizes with different affinities to a region of the 5′-UTR that varies among the different HCV genotypes. [Table - 1] shows the genotype-specific Tm determined using purified HCV monitor PCR product. Figure shows the melting curve analysis of the various genotypes obtained from the sera of different patients.
Discrepancies between our method and the original method of hybridization with sequence-specific oligonucleotides occurred in two of the samples [Table - 2]. Two samples were typed as type 2b by our method, while they were identified as type 4 by the reference laboratory standard method. All other samples were typed correctly and were concordant with the reference laboratory standard method.
| ~ Discussion | |  |
Nucleotide sequence analysis may be regarded as the gold standard for identification of different HCV genotypes and subtypes, but it is generally believed to be impractical for routine clinical laboratory settings. Several alternative HCV-typing procedures have therefore been suggested, which are usually based on the analysis of PCR products by hybridization with genotype-specific probes or restriction length polymorphism analysis.
In this study, we combined a COBAS AMPLICOR HCV MONITOR test with real-time PCR genotyping and compared the results with those yielded by hybridization with sequence-specific oligonucleotides. With this approach, HCV genotyping was possible in about one hour.
The present study demonstrates that melting-curve analysis can be used to identify and classify HCV types/subtypes with considerable confidence. Type 1 HCV is treated differently from other common types of HCV and has a poorer prognosis. Thus, our primary goal in designing this study was to identify type 1 HCV. To meet this goal, the sensor probe chosen was identical in sequence to the type 1 sequence so that DNA from type 1 virus associated with a high Tm. We took advantage of the ability of melting-curve analysis to detect sequence variation(s) with respect to the probe as revealed by an altered Tm. A lower Tm may represent a different genotype or perhaps a minor sequence variation in the type 1 genome. A high Tm indicates target sequence identity and thus the presence of type 1 HCV.
Discrepancies between our method and the oligonucleotide hybridization method occurred in two of the samples [Table - 2]. However, no discrepancies occurred with type 1-the main target of our study. The discrepancies might be due to sample confusion or primer mismatch. We were not able to repeat those assays because of insufficient sample material.
In conclusion, the present report suggests that HCV genotypes can be determined rapidly with FRET probes directly with COBAS AMPLICOR MONITOR test PCR product. The present study further demonstrates that high-specificity identification of the common type 1 virus can be accomplished with a single sensor probe. More samples need to be analyzed by this method to determine the within- and between-run variation of the genotype Tm.
| ~ References | |  |
| 1. | Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989; 244 :359-62. [PUBMED] [FULLTEXT] |
| 2. | Kuo G, Choo QL, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, et al . An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989; 244 :362-4. [PUBMED] [FULLTEXT] |
| 3. | Freeman AJ, Dore GJ, Law MG, Thorpe M, Von Overbeck J, Lloyd AR, et al . Estimating progression to cirrhosis in chronic hepatitis C virus infection. Hepatology 2001; 34 :809-16. [PUBMED] [FULLTEXT] |
| 4. | Davis GL, Lau JY. Factors predictive of a beneficial response to therapy of hepatitis C. Hepatology 1997; 26 :122S-7S. [PUBMED] [FULLTEXT] |
| 5. | Heathcote EJ, Shiffman ML, Cooksley WG, Dusheiko GM, Lee SS, Balart L, et al . Peginterferon alfa-2a in patients with chronic hepatitis C and cirrhosis. N Engl J Med 2000; 343 :1673-80. [PUBMED] [FULLTEXT] |
| 6. | Martinot-Peignoux M, Marcellin P, Pouteau M, Castelnau C, Boyer N, Poliquin M, et al. Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. Hepatology 1995; 22 :1050-6. [PUBMED] |
| 7. | Zeuzem S, Feinman SV, Rasenack J, Heathcote EJ, Lai MY, Gane E, et al. Peginterferon alfa-2a in patients with chronic hepatitis C. N Engl J Med 2000; 343 :1666-72. [PUBMED] [FULLTEXT] |
| 8. | Ross RS, Viazov SO, Holtzer CD, Beyou A, Monnet A, Mazure C, et al. Genotyping of hepatitis C virus isolates using CLIP sequencing. J Clin Microbiol 2000; 38 :3581-4. [PUBMED] [FULLTEXT] |
| 9. | Benhamou JP, Rodes J, Alter H. EASL international Consensus Conference on Hepatitis C. Paris, 26-28, February 1999, Consensus Statement. European Association for the Study of the Liver. J Hepatol 1999; 30 :956-61. |
| 10. | National Institutes of Health Consensus Development Conference Panel statement: Management of hepatitis C. Hepatology 1997; 26 :2S-10S. |
| 11. | Davis GL, Esteban-Mur R, Rustgi V, Hoefs J, Gordon SC, Trepo C, et al . Interferon alfa-2b alone or in combination with ribavirin for the treatment of relapse of chronic hepatitis C. International Hepatitis Interventional Therapy Group. N Engl J Med 1998; 339 :1493-9. |
| 12. | McHutchison JG, Gordon SC, Schiff ER, Shiffman ML, Lee WM, Rustgi VK, et al . Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. Hepatitis Interventional Therapy Group. N Engl J Med 1998; 339 :1485-92. |
| 13. | Krekulova L, Rehak V, Wakil AE, Harris E, Riley LW. Nested restriction site-specific PCR to detect and type hepatitis C virus (HCV): A rapid method to distinguish HCV subtype 1b from other genotypes. J Clin Microbiol 2001; 39 :1774-80. [PUBMED] [FULLTEXT] |
| 14. | Ross RS, Viazov SO, Holtzer CD, Beyou A, Monnet A, Mazure C, et al. Genotyping of hepatitis C virus isolates using CLIP sequencing. J Clin Microbiol 2000; 38 :3581-4. [PUBMED] [FULLTEXT] |
| 15. | Bullock GC, Bruns DE, Haverstick DM. Hepatitis C genotype determination by melting curve analysis with a single set of fluorescence resonance energy transfer probes. Clin Chem 2002; 48 :2147-54. [PUBMED] [FULLTEXT] |
| 16. | Application of PCR Assays in the Characterization of HCV-Associated Disease. In: Goergen B, Meyer zum Büschenfelde KH, Gerken G. PCR: Protocols for Diagnosis of Human and Animal Virus Diseases. Becker Y, Darai G, editors. Springer; 1995. p. 85-94. |
| 17. | Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, et al . Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993; 74 :2391-9. [PUBMED] [FULLTEXT] |
[Figure - 1]
[Table - 1], [Table - 2]
| This article has been cited by | | 1 |
THE POTENTIAL OF HIGH RESOLUTION MELTING ANALYSIS (HRMA) TO STREAMLINE, FACILITATE AND ENRICH ROUTINE DIAGNOSTICS IN MEDICAL MICROBIOLOGY |
|
| Lenka Ruskova, Vladislav Raclavsky | | Biomedical Papers. 2011; : 239 | | [VIEW] | | | 2 |
ICSI outcome in women who have positive PCR result for hepatitis C virus |
|
| N. F. Hanafi, A. H. Abo Ali, H. F. Abo el kheir | | Human Reproduction. 2011; 26(1): 143 | | [VIEW] | | | 3 |
HCV-genotypes: A review on their origin, global status, assay system, pathogenecity and response to treatment |
|
| Irshad, M., Ansari, M.A., Singh, A., Nag, P., Raghvendra, L., Singh, S., Badhal, S.S. | | Hepato-Gastroenterology. 2010; 57(104): 1529-1538 | | [Pubmed] | | | 4 |
Hepatitis C virus genotyping by melting curve analysis in West Azerbaijan, Northwest of Iran |
|
| Omrani, M.-D., Khadem Ansari, M.H. | | Hepatitis Monthly. 2009; 9(2): 133-136 | | [Pubmed] | |
|
 |
|